ID: 1005665840

View in Genome Browser
Species Human (GRCh38)
Location 6:28053417-28053439
Sequence CAGGGAAACCACTGTGAGGT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1005665834_1005665840 15 Left 1005665834 6:28053379-28053401 CCGGGCTGGAGGTAAGCATAGAT No data
Right 1005665840 6:28053417-28053439 CAGGGAAACCACTGTGAGGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1005665840 Original CRISPR CAGGGAAACCACTGTGAGGT GGG Intergenic
No off target data available for this crispr