ID: 1005668538

View in Genome Browser
Species Human (GRCh38)
Location 6:28081378-28081400
Sequence TTACTCTTCCCAAGGGAAGC AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 195
Summary {0: 1, 1: 0, 2: 1, 3: 11, 4: 182}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1005668538_1005668544 1 Left 1005668538 6:28081378-28081400 CCTGCTTCCCTTGGGAAGAGTAA 0: 1
1: 0
2: 1
3: 11
4: 182
Right 1005668544 6:28081402-28081424 CGCCGTTTTGTAGGACACTTGGG 0: 1
1: 0
2: 0
3: 3
4: 37
1005668538_1005668545 2 Left 1005668538 6:28081378-28081400 CCTGCTTCCCTTGGGAAGAGTAA 0: 1
1: 0
2: 1
3: 11
4: 182
Right 1005668545 6:28081403-28081425 GCCGTTTTGTAGGACACTTGGGG 0: 1
1: 0
2: 0
3: 2
4: 71
1005668538_1005668541 -8 Left 1005668538 6:28081378-28081400 CCTGCTTCCCTTGGGAAGAGTAA 0: 1
1: 0
2: 1
3: 11
4: 182
Right 1005668541 6:28081393-28081415 AAGAGTAACCGCCGTTTTGTAGG 0: 1
1: 0
2: 0
3: 0
4: 33
1005668538_1005668543 0 Left 1005668538 6:28081378-28081400 CCTGCTTCCCTTGGGAAGAGTAA 0: 1
1: 0
2: 1
3: 11
4: 182
Right 1005668543 6:28081401-28081423 CCGCCGTTTTGTAGGACACTTGG 0: 1
1: 0
2: 0
3: 1
4: 25

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1005668538 Original CRISPR TTACTCTTCCCAAGGGAAGC AGG (reversed) Exonic
900118789 1:1039949-1039971 TTGCACTTCTCCAGGGAAGCTGG + Intronic
900706699 1:4085246-4085268 TTCCACTTTCCAATGGAAGCTGG + Intergenic
900936791 1:5771066-5771088 TTACTCCGCCCAAGGCCAGCTGG - Intergenic
901861836 1:12079469-12079491 TCTCTCTTCCCCAGGGCAGCAGG + Intronic
902179776 1:14679164-14679186 TTACAGTTCTCAAGAGAAGCGGG + Intronic
903257183 1:22110637-22110659 TTACTGCCCCCAAGGGGAGCTGG - Intergenic
905268973 1:36774259-36774281 CTCCTCTTCCCAAGGGGAGGTGG - Intergenic
905390460 1:37633113-37633135 TTACTCCTCACAATGGAAGGAGG + Intronic
907798145 1:57738038-57738060 TGTCTCTTCCCAAGGCAAGGAGG - Intronic
908034986 1:60042100-60042122 TTTCATTTCCCAAGAGAAGCAGG - Intronic
909490359 1:76219544-76219566 TTTCTGTGCCCAGGGGAAGCTGG - Intronic
910787880 1:91021146-91021168 TTACTCTGCCAGAGGAAAGCAGG - Intronic
912344922 1:108955383-108955405 TTACTCTCCCCACGGAAAGATGG + Intronic
912762350 1:112380241-112380263 TTTCTCTTCCCCAGGTAAGCAGG + Intergenic
914341739 1:146765863-146765885 TTACTGACCCCAAAGGAAGCCGG - Intergenic
915034323 1:152909663-152909685 GTACCCTGCCCAAGGGAAGAGGG + Intronic
915697001 1:157753530-157753552 TTTCTGTTCCCAAGGGAATGGGG + Intronic
919399689 1:197097071-197097093 TTTCTCTTCCCAAGGGGAATTGG - Intronic
920820185 1:209373299-209373321 TTATTGCTCCCAAGAGAAGCAGG + Intergenic
920975448 1:210781381-210781403 TTCCTCTTCCCTAGGGTATCAGG + Intronic
922342969 1:224672240-224672262 ATACACCTCCCCAGGGAAGCAGG - Intronic
922860111 1:228809395-228809417 TTGCTGTTCCCAATGCAAGCAGG - Intergenic
1065707388 10:28483162-28483184 ATACTCTTCACAAGGCAAACTGG - Intergenic
1066579886 10:36868933-36868955 TTACTCTTGCCAAGAGAAGAAGG + Intergenic
1066704876 10:38166483-38166505 TTACTCTTGCCACAGGCAGCAGG - Intergenic
1066985683 10:42464685-42464707 TTACTCTTGCCACAGGCAGCAGG + Intergenic
1068615670 10:59113002-59113024 TTGATGTTCCCAAGGGAAGGTGG - Intergenic
1068905599 10:62318138-62318160 TTATTCTTCCCAAGACAATCAGG - Intergenic
1069304844 10:66956330-66956352 GGATTCTTCCCAAGGGAAGTGGG + Intronic
1075011218 10:118871725-118871747 TTACAGTTCCCAAGAGAAGGGGG - Intergenic
1075529747 10:123219303-123219325 TTTCTCTTCGCAATGGAAGTAGG + Intergenic
1076409002 10:130232652-130232674 TTCCCCTTCCCCAGGGCAGCTGG - Intergenic
1076429338 10:130390931-130390953 TCACAGTTCCCAAGGGAAGGAGG + Intergenic
1079540479 11:21567144-21567166 TCACTCTTCCCAAGTGTAGAAGG - Intronic
1080115344 11:28615671-28615693 CAACTCTGCCCAAGGGAAGCTGG - Intergenic
1083725461 11:64625692-64625714 TTCTTGTTACCAAGGGAAGCTGG - Intronic
1085057524 11:73414964-73414986 TTTCTCTTCCCTGGGGAAGCTGG + Intronic
1089071424 11:115702295-115702317 TTGGTGTTCCCAAGGGATGCTGG - Intergenic
1091540425 12:1455808-1455830 TTACCCCTCTCAAAGGAAGCAGG - Intronic
1092812470 12:12284667-12284689 TTTCTCTTCCCTGGGGGAGCTGG + Intergenic
1093545123 12:20336860-20336882 CTCCTCTAGCCAAGGGAAGCCGG - Intergenic
1097334807 12:58370253-58370275 TCACTCCTCCCAGGGGAAGAAGG - Intergenic
1097650540 12:62292524-62292546 TTGCTGCTCCCATGGGAAGCTGG - Intronic
1098993277 12:77089906-77089928 TTGCTCTTCCCAGGGTCAGCTGG + Intergenic
1102027768 12:109723315-109723337 TTCCTCATCCCCAGGGAAACTGG - Intronic
1107575058 13:41709672-41709694 TGACTCTTCCCCAGGGCAGATGG + Intronic
1108422403 13:50264793-50264815 TTCCTCTTCCCAGGGGAAGGAGG - Intronic
1109922711 13:69089903-69089925 ATATCATTCCCAAGGGAAGCAGG + Intergenic
1111089928 13:83431727-83431749 TTCCTTTTCCCAAGGCAAACAGG - Intergenic
1111623029 13:90748223-90748245 TTTCTCTTCCCCAGGGAAAAGGG - Intergenic
1112948124 13:104956888-104956910 TTACTCTTTTCAAGGGGATCTGG + Intergenic
1113469842 13:110536487-110536509 TTCCTCTCCCCGAGGAAAGCCGG + Intronic
1113554720 13:111223538-111223560 CTACACTTCCCCAGGGAAGCAGG - Intronic
1114805989 14:25837655-25837677 TTAATCTTCTCAGGAGAAGCTGG - Intergenic
1117280212 14:54233443-54233465 TTATTTTTCCCAAGGGAAAAAGG - Intergenic
1117326343 14:54672304-54672326 TTACTCTTCCTAAGCGCAGAAGG + Intronic
1117624151 14:57618448-57618470 CTCCCCTACCCAAGGGAAGCCGG + Intronic
1118098254 14:62564335-62564357 TAACTAATCCCAAAGGAAGCTGG - Intergenic
1118777103 14:68979752-68979774 TTTCTCTTTCCCAGGGAACCTGG + Intergenic
1118887437 14:69878960-69878982 TTACTCTTCCCAGATGCAGCAGG + Intronic
1121881700 14:97506733-97506755 TTACATTTCCCAAGAGAAGGAGG + Intergenic
1123008540 14:105336019-105336041 TTCCTCTGCCCAGGGGCAGCAGG + Intronic
1126106603 15:45150907-45150929 TTACCCTTCACAAGGGCATCTGG - Intronic
1127269804 15:57390307-57390329 GTAATCTGCCCAAGGCAAGCTGG - Intronic
1127855419 15:62949923-62949945 TTACTCCTCCCCAGGTAAGAAGG + Intergenic
1128211658 15:65907711-65907733 TTGCCCTTCCTGAGGGAAGCTGG + Intronic
1130844281 15:87729996-87730018 CTACTATTCCCAGGGTAAGCTGG - Intergenic
1130857756 15:87856340-87856362 TCAGTCTTACTAAGGGAAGCTGG - Intergenic
1130930907 15:88426975-88426997 TTACTCTTACCTAGGGAAGCGGG - Intergenic
1131401105 15:92126238-92126260 TTACTGTTCCCTATGGAAACAGG + Exonic
1132954908 16:2586450-2586472 CTCCTCTTCCCATGGGAATCAGG - Intronic
1133567632 16:7009784-7009806 TTATTTTTCACAAGGCAAGCAGG - Intronic
1134599725 16:15523871-15523893 TTCCTCTCCCCAAGAGAAGATGG + Intronic
1136598852 16:31270452-31270474 TAATTCTGCCCAAGGGAATCAGG - Intronic
1137914114 16:52410213-52410235 TTTCTTTTCCCATGGGAAACTGG - Intergenic
1139195253 16:64910617-64910639 TCTCTCTTCCCAAGGGAATTTGG + Intergenic
1139992540 16:70951579-70951601 TTACTGACCCCAAAGGAAGCCGG + Intronic
1140855437 16:78973843-78973865 TTCCGTTTTCCAAGGGAAGCAGG - Intronic
1143694880 17:8606480-8606502 TTAGTGTTCCCTGGGGAAGCTGG - Intronic
1144999653 17:19295006-19295028 TTTGTCTTCCCATGGGAAGTAGG + Intronic
1146686288 17:34843754-34843776 TTACCGTTCCCAAGGGGAGGGGG + Intergenic
1146773830 17:35594492-35594514 TTCCTATTCCCAAGGGAACTTGG + Intronic
1146823193 17:36000894-36000916 TTACATTTCCCAAGAGAAGGAGG - Intronic
1148221347 17:45864713-45864735 TTCCTCTTCCCCGGGGTAGCCGG + Intergenic
1148291860 17:46458835-46458857 TTACAATTCCCATGGGAGGCCGG - Intergenic
1148314050 17:46676526-46676548 TTACAATTCCCATGGGAGGCCGG - Intronic
1148713387 17:49698250-49698272 TTACTGTTCCCAAAGACAGCTGG + Intergenic
1149042711 17:52209671-52209693 TGACTCATGTCAAGGGAAGCAGG - Intergenic
1153521091 18:5954541-5954563 ATATATTTCCCAAGGGAAGCAGG - Intergenic
1153696334 18:7646551-7646573 TCGCTCTTCCCACAGGAAGCTGG + Intronic
1156001560 18:32390655-32390677 TCTTTCTTCCCAATGGAAGCTGG + Intronic
1158089941 18:53699112-53699134 TTACATTCCCCAGGGGAAGCAGG - Intergenic
1160247310 18:77169200-77169222 TTCATGTTCCCAAGGGCAGCAGG - Intergenic
1161035670 19:2083154-2083176 TTACTCCTTCCTTGGGAAGCAGG - Intronic
1162664722 19:12200728-12200750 TTCCTCTTACCAACGGAATCAGG - Intergenic
1168581746 19:57560532-57560554 GTACTTTTCCCAAGAGAAGAGGG + Intergenic
928961860 2:36934681-36934703 AAACTCTTCCCAACGGAAGAAGG + Intronic
929053242 2:37855569-37855591 TCACTCCTGCCAGGGGAAGCTGG - Intergenic
932222377 2:70009772-70009794 TAACTCTTTCTAAGGGAAGAAGG + Intergenic
932252781 2:70258724-70258746 TTCAGCCTCCCAAGGGAAGCAGG - Intronic
935152913 2:100454453-100454475 TTTCTCTTCCAAAGGGAGTCTGG - Intergenic
936680916 2:114770193-114770215 TCACTCTTCCCCAGAGAGGCAGG - Intronic
938893479 2:135728157-135728179 TTACTCTGCCCAAGCTAATCTGG - Intergenic
945484329 2:210377188-210377210 TTAATCTTCCCAAGGGAGATAGG + Intergenic
947023691 2:225712694-225712716 CTATTCTTCCCTAGGGAAGGAGG + Intergenic
947968447 2:234301907-234301929 TTTCTCTTTCCAAGTGAAGTAGG - Intergenic
1172062882 20:32198807-32198829 TTCCTCTCCCCAAAGGCAGCTGG - Intronic
1172102863 20:32496041-32496063 TTTCTCTGCCAGAGGGAAGCAGG - Intronic
1173239744 20:41283852-41283874 TTACTGTTCCTAAGAGGAGCTGG - Intronic
1173781412 20:45760213-45760235 TTACCCTTCCCCAGAAAAGCGGG - Intronic
1177711780 21:24785221-24785243 TCACTTTTCCAAAGGGTAGCAGG - Intergenic
1178098922 21:29245010-29245032 TTACTCTCCCCAAGTGTAGTTGG + Intronic
1178864515 21:36316906-36316928 CTCCTCTACCCAAGGGAAGCTGG - Intergenic
1182639739 22:31757362-31757384 TCACACTTCCTAAGGCAAGCTGG - Intronic
1182872578 22:33661681-33661703 TTTCTCCTCTCAAGTGAAGCAGG - Intronic
1183369286 22:37423319-37423341 TGACCCTGCCCTAGGGAAGCTGG - Intronic
950597537 3:13997520-13997542 TCCCCCTACCCAAGGGAAGCTGG - Intronic
950652475 3:14415883-14415905 TGACTATTCCCAAGGGGCGCAGG - Intronic
954524878 3:51261325-51261347 CTCCCCTACCCAAGGGAAGCTGG + Intronic
954541127 3:51393418-51393440 AGACTCTTCCCACGGGAAGAAGG + Exonic
956692853 3:71893836-71893858 TGGCTCTGTCCAAGGGAAGCGGG - Intergenic
964390146 3:156188164-156188186 ATAAACTTACCAAGGGAAGCTGG - Intronic
967231377 3:187340595-187340617 TTATTCTTACCAAGAGAATCGGG - Intergenic
968237259 3:197040638-197040660 TTAATCTCCACAAGAGAAGCTGG + Intergenic
968507835 4:979984-980006 TTACATTTCCCAAGAGAAGGGGG + Intronic
969832588 4:9809620-9809642 TAACTTATCCCAAGGGAGGCTGG - Intronic
971325907 4:25643542-25643564 TTCCTCTCTCCAAGAGAAGCAGG - Intergenic
972259788 4:37396488-37396510 CTATTCTTTACAAGGGAAGCAGG + Intronic
973232157 4:47853524-47853546 TAAGCCTTCCCAAGGGAACCTGG + Intronic
973624475 4:52757646-52757668 TCACTCTTCCCCAGGGAAGGAGG + Intergenic
975709103 4:77141344-77141366 ATACTCTTCCCAGGGAAAGTTGG + Intergenic
977577997 4:98695025-98695047 TAACTCTGTCCAAGGGAGGCAGG + Intergenic
982533904 4:156584543-156584565 TTTGTCTTCCCAAGGGGAGTGGG - Intergenic
983049219 4:163025091-163025113 TTTCTCTTCCCTAGGAAATCTGG - Intergenic
983285798 4:165737450-165737472 ATACTCTTACCAAAGTAAGCTGG - Intergenic
983900518 4:173128599-173128621 TAAGGCTTCCCCAGGGAAGCTGG - Intergenic
984837850 4:184039255-184039277 TTAAGCCTACCAAGGGAAGCAGG - Intergenic
985162611 4:187060350-187060372 TAACTCTTCAAAAAGGAAGCAGG + Intergenic
987118586 5:14745750-14745772 TTAACCTTACAAAGGGAAGCAGG + Intronic
988628089 5:32899095-32899117 CTCCTCTAGCCAAGGGAAGCCGG - Intergenic
989418966 5:41213063-41213085 TTACTATCGCCAAGGTAAGCTGG + Intronic
991554423 5:67879346-67879368 TTCATCTTGTCAAGGGAAGCGGG - Intergenic
995574074 5:113511620-113511642 TTGTTCTCCCCAAGAGAAGCAGG + Intergenic
995648439 5:114339919-114339941 TTACTCTTCCTAAAAGAAACTGG - Intergenic
995671541 5:114609728-114609750 TGACTCTTACCATGGGGAGCAGG + Intergenic
995995914 5:118299254-118299276 TTCCTCTTTTCAAGAGAAGCTGG - Intergenic
996579582 5:125016231-125016253 TTAAGCTTGCCTAGGGAAGCTGG + Intergenic
997450817 5:133981669-133981691 CTGCTCTTCCTAAGGGATGCTGG - Intronic
999379357 5:151109535-151109557 TTTCTCCTCCTTAGGGAAGCAGG - Intronic
999634804 5:153610435-153610457 TTTGTCTTCCCCAGGGAATCTGG - Intronic
1000368364 5:160511572-160511594 TTCCTCTTCCCCAGTGGAGCAGG + Intergenic
1000648898 5:163791335-163791357 TTTTTCTTCCTAGGGGAAGCTGG - Intergenic
1000699845 5:164435124-164435146 TTACCATTTCCAAGGGAAGCTGG + Intergenic
1000771897 5:165364961-165364983 TTCCTCTGCACAAGGCAAGCTGG - Intergenic
1001281783 5:170391218-170391240 TATCTCTCCCCCAGGGAAGCAGG - Intronic
1001281798 5:170391353-170391375 GCATTCTTCCCAAGGGAAGGTGG + Intronic
1002099258 5:176849270-176849292 TTTTTTTCCCCAAGGGAAGCTGG - Intronic
1005668538 6:28081378-28081400 TTACTCTTCCCAAGGGAAGCAGG - Exonic
1007966005 6:46004333-46004355 TTCCTCTGTGCAAGGGAAGCTGG - Intronic
1008413298 6:51208472-51208494 TTACTCTTACCAATGTGAGCAGG - Intergenic
1008628764 6:53344240-53344262 ATACTCTTCCAAAGAGAAGAGGG - Intronic
1009856262 6:69268362-69268384 CTACTCATCCCAAAAGAAGCAGG - Intronic
1012186110 6:96219102-96219124 TTACTTTTGCTAAGTGAAGCAGG + Intergenic
1016560575 6:145391781-145391803 TTACTCTTCCCCAGTGCAGCTGG - Intergenic
1018579040 6:165291691-165291713 TAACTCTTCCAAAGAGATGCTGG + Intronic
1021847097 7:24774018-24774040 TTTCTCCTCCTAAAGGAAGCAGG - Intergenic
1023055269 7:36285517-36285539 TAACACTTCCCAAGGGCATCCGG - Intronic
1024131940 7:46362009-46362031 TCACTCTTCCCAAGAAAAGGTGG - Intergenic
1029312220 7:99677980-99678002 TTACTCTACCAGAGGGGAGCTGG - Intronic
1030072465 7:105709773-105709795 TCACACTTCCCAAGAGAAGGGGG - Intronic
1032168144 7:129561975-129561997 TCCCTCTTCCCCAGGGAAGATGG - Intergenic
1033463350 7:141567685-141567707 ATAATCTTCCCCAGGGAAGCTGG - Intronic
1034636658 7:152572667-152572689 TTCCTCTTACCTAGAGAAGCAGG + Intergenic
1034772859 7:153796977-153796999 TCACTCATTCTAAGGGAAGCCGG + Intergenic
1036484319 8:9165679-9165701 CTCCTCCTCCCAGGGGAAGCAGG + Intronic
1036553703 8:9838577-9838599 CTCCCCTACCCAAGGGAAGCCGG + Intergenic
1037794855 8:21984626-21984648 TCTCTATTCCCAAGGGAAGAAGG - Exonic
1038362671 8:26898195-26898217 TTAGTCCTCCCAAGGGAGGGAGG + Intergenic
1042524173 8:69747170-69747192 TTACACTTCCTAAGAGAAGGGGG - Intronic
1045479332 8:102579770-102579792 TCACTCTCCCCAAGAGCAGCTGG + Intergenic
1046053820 8:109055921-109055943 TTATTATTCCCAAGAAAAGCTGG - Intergenic
1046285860 8:112092327-112092349 TTACTCTTCCCAGGCTAAGGAGG - Intergenic
1047784596 8:128141784-128141806 TTACTCTCCCCAAGGGAGTTTGG + Intergenic
1048301295 8:133253131-133253153 ATACCCTTCCCGAGGGTAGCTGG + Intronic
1049843516 8:144788800-144788822 TTTCTCTGCCCCAGGGAAGAGGG + Intergenic
1055859605 9:80731666-80731688 TTAATCTTCGCAAGTGAAGGAGG - Intergenic
1056708312 9:88970063-88970085 TAACTTTTCCCCAGGCAAGCAGG - Intergenic
1058370733 9:104264068-104264090 TCTCTCTTCCCCATGGAAGCAGG + Intergenic
1062295708 9:135825117-135825139 TTGCTTTTCCCGTGGGAAGCTGG - Intronic
1187026538 X:15441160-15441182 TTATTCTACCCAAGCAAAGCAGG + Intronic
1188616900 X:32168448-32168470 AAACTCTTCCAAAGGGAAGATGG - Intronic
1195066847 X:101245024-101245046 TTGCTCTTTCCCAGGGAACCTGG - Exonic
1195363783 X:104108500-104108522 CTTCTGTTCCCAAGGGAGGCAGG + Intronic
1196020531 X:110986320-110986342 TTTCTCTTCCCATGTGAAGGTGG - Intronic
1197660501 X:129166082-129166104 TTATTCTTCCCCAGTGAAGGTGG + Intergenic