ID: 1005669966

View in Genome Browser
Species Human (GRCh38)
Location 6:28095456-28095478
Sequence ATGGTTTAGCACCACCTTCT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1005669961_1005669966 20 Left 1005669961 6:28095413-28095435 CCTGGTGGGAGGTGACTGGATCA 0: 656
1: 3024
2: 5168
3: 7887
4: 10070
Right 1005669966 6:28095456-28095478 ATGGTTTAGCACCACCTTCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1005669966 Original CRISPR ATGGTTTAGCACCACCTTCT TGG Intergenic
No off target data available for this crispr