ID: 1005670883

View in Genome Browser
Species Human (GRCh38)
Location 6:28105028-28105050
Sequence GGAGCCCAGCTCCCCCACGC GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1005670872_1005670883 13 Left 1005670872 6:28104992-28105014 CCCGGCCCTGGCACCGCGGGGTT No data
Right 1005670883 6:28105028-28105050 GGAGCCCAGCTCCCCCACGCGGG No data
1005670873_1005670883 12 Left 1005670873 6:28104993-28105015 CCGGCCCTGGCACCGCGGGGTTG No data
Right 1005670883 6:28105028-28105050 GGAGCCCAGCTCCCCCACGCGGG No data
1005670874_1005670883 8 Left 1005670874 6:28104997-28105019 CCCTGGCACCGCGGGGTTGCCCT No data
Right 1005670883 6:28105028-28105050 GGAGCCCAGCTCCCCCACGCGGG No data
1005670875_1005670883 7 Left 1005670875 6:28104998-28105020 CCTGGCACCGCGGGGTTGCCCTA No data
Right 1005670883 6:28105028-28105050 GGAGCCCAGCTCCCCCACGCGGG No data
1005670876_1005670883 0 Left 1005670876 6:28105005-28105027 CCGCGGGGTTGCCCTAGCCAACC No data
Right 1005670883 6:28105028-28105050 GGAGCCCAGCTCCCCCACGCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1005670883 Original CRISPR GGAGCCCAGCTCCCCCACGC GGG Intergenic
No off target data available for this crispr