ID: 1005670957

View in Genome Browser
Species Human (GRCh38)
Location 6:28105574-28105596
Sequence GAGACCACACCTGGTGCTCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1005670957_1005670963 2 Left 1005670957 6:28105574-28105596 CCCTGAGCACCAGGTGTGGTCTC No data
Right 1005670963 6:28105599-28105621 CTGCCAGCCCCTCGATGACCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1005670957 Original CRISPR GAGACCACACCTGGTGCTCA GGG (reversed) Intergenic