ID: 1005670963

View in Genome Browser
Species Human (GRCh38)
Location 6:28105599-28105621
Sequence CTGCCAGCCCCTCGATGACC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1005670954_1005670963 21 Left 1005670954 6:28105555-28105577 CCAAAAAACAGAGAAGTGTCCCT No data
Right 1005670963 6:28105599-28105621 CTGCCAGCCCCTCGATGACCAGG No data
1005670957_1005670963 2 Left 1005670957 6:28105574-28105596 CCCTGAGCACCAGGTGTGGTCTC No data
Right 1005670963 6:28105599-28105621 CTGCCAGCCCCTCGATGACCAGG No data
1005670958_1005670963 1 Left 1005670958 6:28105575-28105597 CCTGAGCACCAGGTGTGGTCTCC No data
Right 1005670963 6:28105599-28105621 CTGCCAGCCCCTCGATGACCAGG No data
1005670959_1005670963 -7 Left 1005670959 6:28105583-28105605 CCAGGTGTGGTCTCCCCTGCCAG No data
Right 1005670963 6:28105599-28105621 CTGCCAGCCCCTCGATGACCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1005670963 Original CRISPR CTGCCAGCCCCTCGATGACC AGG Intergenic