ID: 1005677718

View in Genome Browser
Species Human (GRCh38)
Location 6:28172871-28172893
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1005677715_1005677718 0 Left 1005677715 6:28172848-28172870 CCATGCTGTTTTATGTAAGGGAC No data
Right 1005677718 6:28172871-28172893 CTGTGCATGCTGAGGTGTCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1005677718 Original CRISPR CTGTGCATGCTGAGGTGTCC TGG Intergenic
No off target data available for this crispr