ID: 1005681943

View in Genome Browser
Species Human (GRCh38)
Location 6:28216903-28216925
Sequence AGAGGTTGTGGGGAGGGAGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1005681943_1005681957 15 Left 1005681943 6:28216903-28216925 CCACCTCCCTCCCCACAACCTCT No data
Right 1005681957 6:28216941-28216963 GGCTGCATGAGAGAAAGAAAAGG No data
1005681943_1005681952 -6 Left 1005681943 6:28216903-28216925 CCACCTCCCTCCCCACAACCTCT No data
Right 1005681952 6:28216920-28216942 ACCTCTGCCCCAGGGAGAAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1005681943 Original CRISPR AGAGGTTGTGGGGAGGGAGG TGG (reversed) Intergenic
No off target data available for this crispr