ID: 1005681944

View in Genome Browser
Species Human (GRCh38)
Location 6:28216906-28216928
Sequence GGCAGAGGTTGTGGGGAGGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1005681944_1005681952 -9 Left 1005681944 6:28216906-28216928 CCTCCCTCCCCACAACCTCTGCC No data
Right 1005681952 6:28216920-28216942 ACCTCTGCCCCAGGGAGAAGAGG No data
1005681944_1005681958 28 Left 1005681944 6:28216906-28216928 CCTCCCTCCCCACAACCTCTGCC No data
Right 1005681958 6:28216957-28216979 GAAAAGGCCATATGCATCAGTGG No data
1005681944_1005681957 12 Left 1005681944 6:28216906-28216928 CCTCCCTCCCCACAACCTCTGCC No data
Right 1005681957 6:28216941-28216963 GGCTGCATGAGAGAAAGAAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1005681944 Original CRISPR GGCAGAGGTTGTGGGGAGGG AGG (reversed) Intergenic
No off target data available for this crispr