ID: 1005681951

View in Genome Browser
Species Human (GRCh38)
Location 6:28216915-28216937
Sequence TCTCCCTGGGGCAGAGGTTG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1005681951_1005681962 27 Left 1005681951 6:28216915-28216937 CCACAACCTCTGCCCCAGGGAGA No data
Right 1005681962 6:28216965-28216987 CATATGCATCAGTGGCTGGGTGG No data
1005681951_1005681958 19 Left 1005681951 6:28216915-28216937 CCACAACCTCTGCCCCAGGGAGA No data
Right 1005681958 6:28216957-28216979 GAAAAGGCCATATGCATCAGTGG No data
1005681951_1005681959 23 Left 1005681951 6:28216915-28216937 CCACAACCTCTGCCCCAGGGAGA No data
Right 1005681959 6:28216961-28216983 AGGCCATATGCATCAGTGGCTGG No data
1005681951_1005681960 24 Left 1005681951 6:28216915-28216937 CCACAACCTCTGCCCCAGGGAGA No data
Right 1005681960 6:28216962-28216984 GGCCATATGCATCAGTGGCTGGG No data
1005681951_1005681957 3 Left 1005681951 6:28216915-28216937 CCACAACCTCTGCCCCAGGGAGA No data
Right 1005681957 6:28216941-28216963 GGCTGCATGAGAGAAAGAAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1005681951 Original CRISPR TCTCCCTGGGGCAGAGGTTG TGG (reversed) Intergenic
No off target data available for this crispr