ID: 1005681953

View in Genome Browser
Species Human (GRCh38)
Location 6:28216921-28216943
Sequence GCCTCTTCTCCCTGGGGCAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1005681953_1005681962 21 Left 1005681953 6:28216921-28216943 CCTCTGCCCCAGGGAGAAGAGGC No data
Right 1005681962 6:28216965-28216987 CATATGCATCAGTGGCTGGGTGG No data
1005681953_1005681957 -3 Left 1005681953 6:28216921-28216943 CCTCTGCCCCAGGGAGAAGAGGC No data
Right 1005681957 6:28216941-28216963 GGCTGCATGAGAGAAAGAAAAGG No data
1005681953_1005681958 13 Left 1005681953 6:28216921-28216943 CCTCTGCCCCAGGGAGAAGAGGC No data
Right 1005681958 6:28216957-28216979 GAAAAGGCCATATGCATCAGTGG No data
1005681953_1005681963 26 Left 1005681953 6:28216921-28216943 CCTCTGCCCCAGGGAGAAGAGGC No data
Right 1005681963 6:28216970-28216992 GCATCAGTGGCTGGGTGGCCAGG No data
1005681953_1005681959 17 Left 1005681953 6:28216921-28216943 CCTCTGCCCCAGGGAGAAGAGGC No data
Right 1005681959 6:28216961-28216983 AGGCCATATGCATCAGTGGCTGG No data
1005681953_1005681964 27 Left 1005681953 6:28216921-28216943 CCTCTGCCCCAGGGAGAAGAGGC No data
Right 1005681964 6:28216971-28216993 CATCAGTGGCTGGGTGGCCAGGG No data
1005681953_1005681960 18 Left 1005681953 6:28216921-28216943 CCTCTGCCCCAGGGAGAAGAGGC No data
Right 1005681960 6:28216962-28216984 GGCCATATGCATCAGTGGCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1005681953 Original CRISPR GCCTCTTCTCCCTGGGGCAG AGG (reversed) Intergenic