ID: 1005681957

View in Genome Browser
Species Human (GRCh38)
Location 6:28216941-28216963
Sequence GGCTGCATGAGAGAAAGAAA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1005681946_1005681957 8 Left 1005681946 6:28216910-28216932 CCTCCCCACAACCTCTGCCCCAG No data
Right 1005681957 6:28216941-28216963 GGCTGCATGAGAGAAAGAAAAGG No data
1005681955_1005681957 -10 Left 1005681955 6:28216928-28216950 CCCAGGGAGAAGAGGCTGCATGA No data
Right 1005681957 6:28216941-28216963 GGCTGCATGAGAGAAAGAAAAGG No data
1005681943_1005681957 15 Left 1005681943 6:28216903-28216925 CCACCTCCCTCCCCACAACCTCT No data
Right 1005681957 6:28216941-28216963 GGCTGCATGAGAGAAAGAAAAGG No data
1005681954_1005681957 -9 Left 1005681954 6:28216927-28216949 CCCCAGGGAGAAGAGGCTGCATG No data
Right 1005681957 6:28216941-28216963 GGCTGCATGAGAGAAAGAAAAGG No data
1005681950_1005681957 4 Left 1005681950 6:28216914-28216936 CCCACAACCTCTGCCCCAGGGAG No data
Right 1005681957 6:28216941-28216963 GGCTGCATGAGAGAAAGAAAAGG No data
1005681949_1005681957 5 Left 1005681949 6:28216913-28216935 CCCCACAACCTCTGCCCCAGGGA No data
Right 1005681957 6:28216941-28216963 GGCTGCATGAGAGAAAGAAAAGG No data
1005681945_1005681957 9 Left 1005681945 6:28216909-28216931 CCCTCCCCACAACCTCTGCCCCA No data
Right 1005681957 6:28216941-28216963 GGCTGCATGAGAGAAAGAAAAGG No data
1005681953_1005681957 -3 Left 1005681953 6:28216921-28216943 CCTCTGCCCCAGGGAGAAGAGGC No data
Right 1005681957 6:28216941-28216963 GGCTGCATGAGAGAAAGAAAAGG No data
1005681944_1005681957 12 Left 1005681944 6:28216906-28216928 CCTCCCTCCCCACAACCTCTGCC No data
Right 1005681957 6:28216941-28216963 GGCTGCATGAGAGAAAGAAAAGG No data
1005681951_1005681957 3 Left 1005681951 6:28216915-28216937 CCACAACCTCTGCCCCAGGGAGA No data
Right 1005681957 6:28216941-28216963 GGCTGCATGAGAGAAAGAAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1005681957 Original CRISPR GGCTGCATGAGAGAAAGAAA AGG Intergenic
No off target data available for this crispr