ID: 1005681960

View in Genome Browser
Species Human (GRCh38)
Location 6:28216962-28216984
Sequence GGCCATATGCATCAGTGGCT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1005681945_1005681960 30 Left 1005681945 6:28216909-28216931 CCCTCCCCACAACCTCTGCCCCA No data
Right 1005681960 6:28216962-28216984 GGCCATATGCATCAGTGGCTGGG No data
1005681946_1005681960 29 Left 1005681946 6:28216910-28216932 CCTCCCCACAACCTCTGCCCCAG No data
Right 1005681960 6:28216962-28216984 GGCCATATGCATCAGTGGCTGGG No data
1005681953_1005681960 18 Left 1005681953 6:28216921-28216943 CCTCTGCCCCAGGGAGAAGAGGC No data
Right 1005681960 6:28216962-28216984 GGCCATATGCATCAGTGGCTGGG No data
1005681949_1005681960 26 Left 1005681949 6:28216913-28216935 CCCCACAACCTCTGCCCCAGGGA No data
Right 1005681960 6:28216962-28216984 GGCCATATGCATCAGTGGCTGGG No data
1005681955_1005681960 11 Left 1005681955 6:28216928-28216950 CCCAGGGAGAAGAGGCTGCATGA No data
Right 1005681960 6:28216962-28216984 GGCCATATGCATCAGTGGCTGGG No data
1005681954_1005681960 12 Left 1005681954 6:28216927-28216949 CCCCAGGGAGAAGAGGCTGCATG No data
Right 1005681960 6:28216962-28216984 GGCCATATGCATCAGTGGCTGGG No data
1005681951_1005681960 24 Left 1005681951 6:28216915-28216937 CCACAACCTCTGCCCCAGGGAGA No data
Right 1005681960 6:28216962-28216984 GGCCATATGCATCAGTGGCTGGG No data
1005681950_1005681960 25 Left 1005681950 6:28216914-28216936 CCCACAACCTCTGCCCCAGGGAG No data
Right 1005681960 6:28216962-28216984 GGCCATATGCATCAGTGGCTGGG No data
1005681956_1005681960 10 Left 1005681956 6:28216929-28216951 CCAGGGAGAAGAGGCTGCATGAG No data
Right 1005681960 6:28216962-28216984 GGCCATATGCATCAGTGGCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1005681960 Original CRISPR GGCCATATGCATCAGTGGCT GGG Intergenic
No off target data available for this crispr