ID: 1005681964

View in Genome Browser
Species Human (GRCh38)
Location 6:28216971-28216993
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1005681956_1005681964 19 Left 1005681956 6:28216929-28216951 CCAGGGAGAAGAGGCTGCATGAG No data
Right 1005681964 6:28216971-28216993 CATCAGTGGCTGGGTGGCCAGGG No data
1005681955_1005681964 20 Left 1005681955 6:28216928-28216950 CCCAGGGAGAAGAGGCTGCATGA No data
Right 1005681964 6:28216971-28216993 CATCAGTGGCTGGGTGGCCAGGG No data
1005681954_1005681964 21 Left 1005681954 6:28216927-28216949 CCCCAGGGAGAAGAGGCTGCATG No data
Right 1005681964 6:28216971-28216993 CATCAGTGGCTGGGTGGCCAGGG No data
1005681953_1005681964 27 Left 1005681953 6:28216921-28216943 CCTCTGCCCCAGGGAGAAGAGGC No data
Right 1005681964 6:28216971-28216993 CATCAGTGGCTGGGTGGCCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1005681964 Original CRISPR CATCAGTGGCTGGGTGGCCA GGG Intergenic