ID: 1005687571

View in Genome Browser
Species Human (GRCh38)
Location 6:28269726-28269748
Sequence TAGTCAGACTTTTAACTGCT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 238
Summary {0: 1, 1: 0, 2: 3, 3: 18, 4: 216}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1005687571 Original CRISPR TAGTCAGACTTTTAACTGCT TGG Intronic
902457033 1:16541116-16541138 CAGTCAGACTTTTCACTGACTGG + Intergenic
902474663 1:16675688-16675710 CAGTCAGACTTTTCACTGACTGG + Intergenic
902484199 1:16732056-16732078 CAGTCAGACTTTTCACTGACTGG - Intergenic
902495137 1:16866798-16866820 CAGTCAGACTTTTCACTGACTGG - Intronic
902651088 1:17838111-17838133 CAGCCAGTCTTCTAACTGCTGGG - Intergenic
906810364 1:48820511-48820533 TATTCAGACTTTCAACTGATTGG - Intronic
906899007 1:49812857-49812879 CAGTGAGACTTTGAACTGTTGGG - Intronic
908497345 1:64707835-64707857 TAGTCAGTCTTTTAACGGATTGG - Intergenic
912131597 1:106609016-106609038 TAGTCAGACTTTTAACATCCAGG + Intergenic
914228545 1:145743249-145743271 TATTCAGACCTTCAACTGATTGG - Exonic
914674181 1:149895688-149895710 TAGTCAAGCTTTCAACTGGTTGG + Intronic
914866345 1:151433024-151433046 TAGTCATTATTTTAACTGCTAGG + Intronic
917000760 1:170355796-170355818 TAGTCAGTTTTTTAGCTACTTGG + Intergenic
918866927 1:189913239-189913261 TAGCTAGAGTTTTAACTGATTGG + Intergenic
921155526 1:212435318-212435340 TATGCAGACTTTTGACTGCATGG - Intronic
921429376 1:215046111-215046133 TACTCAGACTTGTAAATTCTAGG + Intronic
921516618 1:216100202-216100224 TGGACAGACTCTTGACTGCTGGG + Intronic
921893477 1:220375888-220375910 TAGTCAGGCCTTCAACTGATTGG + Intergenic
922812249 1:228423757-228423779 TAGCCAGCCTTTTAACTGAATGG + Intergenic
1064298485 10:14100508-14100530 TATTCAGACTTTTAAGGGGTCGG - Intronic
1065785749 10:29212789-29212811 TAGTCAGGCCTTCAACTGATTGG - Intergenic
1066063187 10:31742454-31742476 TATTCAGGCCTTCAACTGCTTGG - Intergenic
1066318728 10:34277817-34277839 TGGGCAGTCTTTTAACTGCCTGG - Intronic
1068456315 10:57258290-57258312 TAGTCAGACATTTAAATACATGG + Intergenic
1068486103 10:57660927-57660949 TAGTGATTCTTTTAACTGTTAGG - Intergenic
1068865748 10:61894342-61894364 TAGTCAGGCCTTCAACTGATTGG + Intergenic
1069157482 10:65049329-65049351 TAGTTTGACTTCTAACTGGTAGG + Intergenic
1069357761 10:67607182-67607204 TACTCAGATTTTCAACTGCACGG - Intronic
1069646314 10:70000917-70000939 TATTTATACTTTTATCTGCTTGG - Intergenic
1070969876 10:80554625-80554647 TCTTAAGGCTTTTAACTGCTTGG + Intronic
1071252038 10:83828665-83828687 TATTTAGGCTTTTAACTGATTGG - Intergenic
1071782717 10:88864235-88864257 TAGTCAGGATATTAAATGCTAGG + Intergenic
1074188967 10:111119355-111119377 TATTAAGACTTTCAACTGATTGG - Intergenic
1074855295 10:117468872-117468894 TAGTCAGGCCTTCAACTGATTGG - Intergenic
1075433964 10:122417779-122417801 TAATGAGATTTTTCACTGCTTGG + Intronic
1077399221 11:2345249-2345271 TAGTCAGACCTTCAACTGATTGG - Intergenic
1078830860 11:14974957-14974979 CAGTCAGTCTTGAAACTGCTCGG - Intronic
1079036140 11:17021835-17021857 TATTCAGACTTTCAGCTGATCGG + Intergenic
1079927293 11:26510278-26510300 AAGTCAGAATTTTACTTGCTGGG - Intronic
1079971741 11:27043375-27043397 AAGTTATACTTTTAAGTGCTGGG + Intronic
1080254946 11:30280268-30280290 TACTCAGACTGTCAACTGATTGG + Intergenic
1080431630 11:32204940-32204962 TAGTCAGGCCTTCAACTGATTGG + Intergenic
1086124320 11:83334333-83334355 TAGTCAGGCTTTCAATTGATTGG - Intergenic
1086430929 11:86736265-86736287 GAGTCAGATTTGTAACTTCTCGG - Intergenic
1089126178 11:116178053-116178075 TATTCAGGCCTTTAACTGATTGG - Intergenic
1091921272 12:4306803-4306825 CAGTCAGATTTCTCACTGCTCGG - Intergenic
1094539881 12:31354388-31354410 GATTCAGACTTTTCCCTGCTTGG - Intergenic
1094668025 12:32540986-32541008 TAGTCAGACTTTTTATTTGTAGG + Intronic
1095309082 12:40674715-40674737 TAGTCAGACCTTCAAGTGATTGG - Intergenic
1095781072 12:46060220-46060242 TATTCAGATTTGTCACTGCTAGG - Intergenic
1098517375 12:71392944-71392966 TAATCACGCTTTTAATTGCTAGG - Intronic
1098687865 12:73448384-73448406 TCTTCAGAGTTTTAACTACTTGG + Intergenic
1099240779 12:80135827-80135849 TACTCAGACCTTCAACTGATTGG - Intergenic
1101548788 12:105742315-105742337 ATGTCAGACTTTGAAATGCTGGG + Intergenic
1101609852 12:106281079-106281101 TGGTCAGACTTTTAAATTTTAGG - Intronic
1101739343 12:107488138-107488160 TACCCAGACTCTTGACTGCTCGG - Intronic
1102944365 12:116972876-116972898 TAGTGATACTTTCAACAGCTGGG - Intronic
1106276413 13:28212421-28212443 TAATGTGACTTTTATCTGCTGGG - Intronic
1106715179 13:32381206-32381228 TAGACAGTGTTTTAAGTGCTGGG + Intronic
1111407747 13:87832021-87832043 TACTCAGCCTTTCAACTGATTGG + Intergenic
1111761206 13:92467692-92467714 GAGTCGTATTTTTAACTGCTGGG + Intronic
1113122811 13:106942458-106942480 TACTCAGATCTTTAACTGATTGG - Intergenic
1114735791 14:25042501-25042523 TAGGCACACTTCTACCTGCTCGG + Intronic
1116115715 14:40647561-40647583 TAATCAAACTTTTATCTGCCTGG - Intergenic
1116727753 14:48583697-48583719 TATTCAGTCCTTTAACTGATTGG - Intergenic
1119644038 14:76335750-76335772 AAGTTGGACTTTTACCTGCTGGG + Intronic
1120493873 14:85209779-85209801 TAATCAGAATTTTCACAGCTTGG - Intergenic
1122495261 14:102149239-102149261 TAGTCTGACCTTGAACTCCTGGG + Intronic
1123452461 15:20378368-20378390 TAGTCAGACCTTTAACTGATTGG + Intergenic
1124911904 15:33929404-33929426 TAGACAGTCTTTCAACTGATAGG + Intronic
1126554988 15:49976706-49976728 TCTTCAGACTTTTAAGTTCTAGG - Intronic
1127572915 15:60261703-60261725 TGGTCAGACTCTCAACTGCAGGG - Intergenic
1128816689 15:70615112-70615134 TATTCAGGCCTTCAACTGCTGGG + Intergenic
1131458332 15:92600641-92600663 TACTCAGAATTGTAAGTGCTTGG - Intergenic
1134599897 16:15525155-15525177 TAGTCAGGCCTTCAACTGATTGG - Intronic
1135644882 16:24153087-24153109 TAGCCAGACCTTTTGCTGCTGGG + Intronic
1137343237 16:47630804-47630826 TTTTCAGACTTTTAGCTGATTGG - Intronic
1139052164 16:63138120-63138142 TAGTTAGATTTTTATCTCCTTGG + Intergenic
1140950187 16:79809549-79809571 TGGTCTGAATTATAACTGCTGGG - Intergenic
1143302404 17:5920306-5920328 CAGACAGACTTCTAACTGCTAGG - Intronic
1143929493 17:10407056-10407078 TAGACAGTCCTTTAACTACTAGG + Intronic
1144279086 17:13706524-13706546 TATTCAGATTTTCAACTGCATGG - Intergenic
1151011453 17:70502683-70502705 TATTCTTACTTTTAACTGCTTGG + Intergenic
1151399389 17:73845851-73845873 TATTCAGGCCTTTAACTGATTGG - Intergenic
1151633532 17:75327847-75327869 TAGTCTGACATCTACCTGCTTGG + Intronic
1155041766 18:22070800-22070822 AAGTCAGACTTGTGACTCCTAGG + Intergenic
1156485053 18:37460018-37460040 CATTCAGAATTTGAACTGCTAGG - Intronic
1157115529 18:44859310-44859332 AAGTCTGACTTTTACCTGCATGG + Intronic
1157358671 18:46958028-46958050 TACTCAGACCTTTGACTGATTGG - Intronic
1159223259 18:65493964-65493986 TAGCAAGACATTTAACAGCTTGG - Intergenic
1163802386 19:19374220-19374242 TAGTCTCACTTTGAACTCCTGGG - Intergenic
1164397651 19:27879948-27879970 TAGGCTGACCTATAACTGCTAGG + Intergenic
1164405234 19:27938353-27938375 TCTTCAGACTTTAAACTTCTGGG + Intergenic
1165663553 19:37604944-37604966 TACTGAGACTTCTAACTACTTGG - Intronic
1202707983 1_KI270713v1_random:37771-37793 CAGTCAGACTTTTCACTGACTGG + Intergenic
926482729 2:13419921-13419943 TACTCAGACCTTCAACTGATTGG - Intergenic
927225189 2:20757709-20757731 TAGTCAGACCTTCAACTGATTGG - Intronic
929617564 2:43323966-43323988 TGGTCAGGCTTTTAAGTGATGGG + Intronic
930166120 2:48205321-48205343 TAATCAGTCTTTTATCAGCTTGG + Intergenic
930783206 2:55244460-55244482 TAGGCTGACTTTGAACTCCTGGG - Intronic
931509480 2:62975032-62975054 TAGGAAGACTTTTAACAGTTGGG + Intronic
936244762 2:110817004-110817026 TAGGCAGACTGTTAACACCTGGG - Intronic
936289022 2:111204462-111204484 TATTCAGTCTTTCAACTGATTGG - Intergenic
936584684 2:113745592-113745614 TATTCTAACTTTCAACTGCTGGG - Intronic
937023164 2:118676871-118676893 AAGCCAGACTTTTAAATGCTGGG - Intergenic
937474161 2:122199881-122199903 TACTCAGATTTTTGACTGTTCGG - Intergenic
937667920 2:124507632-124507654 TTTTCAGACTTTTAAATGTTTGG + Intronic
937962477 2:127471095-127471117 TATTCAGACTTTTCATTCCTTGG - Intronic
939378940 2:141409033-141409055 AAGTCAGACTTTCATTTGCTAGG + Intronic
940627564 2:156194475-156194497 TATTCAGACTTTCGACTGATTGG + Intergenic
942787627 2:179718265-179718287 TAGTGAGAATTTTAAATACTGGG + Intronic
944215279 2:197248265-197248287 TATTCAGGTTTTTAACTGATTGG - Intronic
944495162 2:200299936-200299958 TACTCAGATTTTTGACTGCATGG - Intergenic
944869804 2:203898639-203898661 TATTCAGGCCTTTAACTGATGGG - Intergenic
945682691 2:212933202-212933224 TATTCAGACCTTCAACTGATTGG + Intergenic
946963161 2:225006388-225006410 TAATCAGGCTCTTATCTGCTAGG + Intronic
947294821 2:228618651-228618673 TAGTCAGACCTTTAACTGATCGG - Intergenic
948571635 2:238921457-238921479 TAGTCAGGCCTTCAACTGATTGG - Intergenic
1169735667 20:8834937-8834959 TATTCAGACCTTCAACTGGTTGG + Intronic
1170005468 20:11663684-11663706 TATTCAGGCTTTCAACTGATTGG - Intergenic
1172970558 20:38870364-38870386 TAGTCAGACTTTTAAATGGTAGG - Intronic
1174696282 20:52562257-52562279 TAATTACATTTTTAACTGCTTGG - Intergenic
1175282829 20:57815573-57815595 TATTCAGGCTTTCAACTGATTGG + Intergenic
1176410432 21:6446882-6446904 TATTCAGGCCTTCAACTGCTTGG - Intergenic
1176921405 21:14691603-14691625 TTGCCAGAATTTTGACTGCTTGG - Intergenic
1177041867 21:16122456-16122478 TTGTCAGCTTTTTATCTGCTTGG + Intergenic
1178219673 21:30642022-30642044 TACTCAGATTTTCAACTGCGTGG - Intergenic
1178747650 21:35268435-35268457 TATTCAGACCTTCAACTGATTGG + Intronic
1179685925 21:43055204-43055226 TATTCAGGCCTTCAACTGCTTGG - Intronic
1180657768 22:17437747-17437769 TTGTCAGACTTTAAAATGCAAGG + Intronic
1181929425 22:26388055-26388077 TATTCAGACCTTCAACTGATGGG + Intergenic
1182817749 22:33181434-33181456 TAGTCAGAAGTTACACTGCTAGG + Intronic
1183568958 22:38637828-38637850 TATCCAAACCTTTAACTGCTAGG - Intronic
950767992 3:15288163-15288185 TATTCAGACCTTTAACTGATTGG + Intronic
951169419 3:19522481-19522503 TATTCAGACCTTCAACTGATTGG + Intronic
951856807 3:27206265-27206287 TAGTCACTCTTCTACCTGCTTGG + Intronic
955661406 3:61303399-61303421 TATTCTGACTTTTCATTGCTGGG - Intergenic
957036390 3:75297180-75297202 TAAACTGACTTTTAATTGCTAGG + Intergenic
957124725 3:76143969-76143991 TATTCAGGCCTTTAACTGATTGG + Intronic
957570156 3:81936874-81936896 TGATCAGACTTTTATCTCCTTGG - Intergenic
957884708 3:86271264-86271286 TAGTCACAGTTTTCACTGCCTGG - Intergenic
958442498 3:94173190-94173212 TTGTGAGACACTTAACTGCTAGG + Intergenic
958786315 3:98600145-98600167 TATTCAGACCTTCAACTGATTGG - Intergenic
958993911 3:100879228-100879250 TTCTGAGACTTTTAAGTGCTTGG + Intronic
962586340 3:136846056-136846078 TATTCAGGCTTTCAACTGATTGG - Intronic
964634257 3:158843229-158843251 TAGGCAGCATTTGAACTGCTTGG + Intergenic
965379058 3:167965665-167965687 TAGTCAGACCTTCCACTGATTGG - Intergenic
965778792 3:172261599-172261621 TAGTGAGACTTTGAAATTCTAGG + Intronic
966438940 3:179922091-179922113 TAGACCGACTTGTAACTGCTGGG + Intronic
969443451 4:7231272-7231294 TATTCAGACCTTTAACTGATTGG + Intronic
974759952 4:66262285-66262307 TATTCTGACTTTTAATTTCTAGG + Intergenic
975936415 4:79586337-79586359 TACTCAAACTTATATCTGCTTGG - Intergenic
976457742 4:85268250-85268272 TATTTAGGCTTTTAACTGATTGG - Intergenic
976525989 4:86089369-86089391 TAGTCTGACTTTTCACTGACTGG + Intronic
976624800 4:87168134-87168156 TAGTTAGACTTTCAACTACAAGG + Intronic
977587734 4:98793098-98793120 TAATCACAATTTTAAATGCTAGG - Intergenic
977643242 4:99381587-99381609 AAGTCAAACTTTTTATTGCTAGG + Intergenic
978707869 4:111737564-111737586 TAGACATACTTTTAACAGTTTGG - Intergenic
979361143 4:119766094-119766116 TACTCAGACTTTTAGCTTCCAGG + Intergenic
980288116 4:130807206-130807228 TATTTGGATTTTTAACTGCTAGG + Intergenic
980288125 4:130807348-130807370 TATTTGGATTTTTAACTGCTAGG + Intergenic
980313974 4:131172577-131172599 TATTCAGACCTTCAACTGATTGG - Intergenic
981294014 4:143109027-143109049 TACTCAGACTTCTATCAGCTTGG - Intergenic
981608730 4:146569351-146569373 TATTCAGACCCTCAACTGCTTGG + Intergenic
983587350 4:169370244-169370266 TATTCAGGCCTTTAACTGATTGG - Intergenic
985225889 4:187761592-187761614 TAGTCACACCTTCAACTGATTGG + Intergenic
986384658 5:7220234-7220256 TATTCAGGCCTTTAACTGATTGG - Intergenic
986964062 5:13248846-13248868 AAGTCAGACTTTTAATTATTAGG - Intergenic
987257142 5:16167487-16167509 TAGTCAGGCTTTGAACTGACTGG + Intronic
988328677 5:29806011-29806033 TAGTCAGGCCTTCAACTGATTGG - Intergenic
988331131 5:29841369-29841391 TATTCAGGCTTTCAACTGATGGG + Intergenic
990314625 5:54572238-54572260 TTTTCTGTCTTTTAACTGCTTGG + Intergenic
990556148 5:56938082-56938104 TAGTCGGACTTTTAAATTATTGG - Intronic
992878526 5:81081800-81081822 TAGTCAGATTTTTAACCGAAAGG + Intronic
993315741 5:86403745-86403767 TATTCAGAACTTTAACTGATTGG + Intergenic
995099069 5:108276589-108276611 TAGTAAGAAATTTTACTGCTAGG - Intronic
995294573 5:110504727-110504749 TATTCAGACCTTCAACTGATTGG + Intronic
995793670 5:115920507-115920529 TAGTCAGGCCTTTAACTGATTGG + Intergenic
999668297 5:153935733-153935755 TATTCAGACTTTCAATTGATTGG + Intergenic
999850618 5:155534007-155534029 TTATGAGACTTTTAACTGTTTGG - Intergenic
999957584 5:156719275-156719297 TATTGAGACTTTCAACTGATTGG + Intronic
1000116145 5:158155155-158155177 TAGTAAGAATATTAACTCCTAGG + Intergenic
1000847527 5:166300100-166300122 TACACAGATTTTCAACTGCTTGG - Intergenic
1000930237 5:167242814-167242836 TACACAGACTTTCAACTGCATGG + Intergenic
1002403309 5:179006746-179006768 TAGTCAGGCCTTCAACTGATTGG + Intergenic
1005687571 6:28269726-28269748 TAGTCAGACTTTTAACTGCTTGG + Intronic
1007100176 6:39240584-39240606 GAGCCAGGCTTTTACCTGCTGGG + Intergenic
1008116200 6:47553158-47553180 TAGTCACAGTGTTAACTACTAGG - Intronic
1009587489 6:65626172-65626194 TAGTCAGACTATTCAGTCCTGGG + Intronic
1009840718 6:69070267-69070289 TATTCAGATTTTTGAATGCTTGG - Intronic
1011818965 6:91227990-91228012 TATTCAGACTTTCAACTGATTGG + Intergenic
1012857014 6:104514003-104514025 TACGCAGATTTTTAACTGCCTGG - Intergenic
1013036585 6:106390934-106390956 TACTCAGAATTTGAATTGCTGGG + Intergenic
1013463200 6:110395212-110395234 TATTCAGGCTTTCAACTGATAGG - Intronic
1014544405 6:122716430-122716452 CCATTAGACTTTTAACTGCTTGG - Intronic
1014571922 6:123019981-123020003 TATTCAGACTTTTGACAGATTGG + Intronic
1015964116 6:138681324-138681346 GAGTGAGACTTTTCACTGCATGG + Intronic
1016019654 6:139222849-139222871 TAGTAAGAGCTTTAACTGATAGG + Intergenic
1016316633 6:142796305-142796327 TATGCAGATTTTCAACTGCTCGG - Intronic
1017554810 6:155551613-155551635 TAGTCAGATTTTTAACATTTGGG - Intergenic
1018773317 6:166991572-166991594 TATTCAGGCTTCTAACTGATTGG - Intergenic
1021304772 7:19019193-19019215 TATTCAGACTTTCAACTGGTTGG + Intergenic
1021815781 7:24446415-24446437 TACCCTGACTTTTATCTGCTTGG + Intergenic
1022240117 7:28503050-28503072 TAGGCAGACTATGAACTGATAGG + Intronic
1024863568 7:53876359-53876381 TAATCAGACCTTGAACTGATTGG + Intergenic
1026184967 7:68075318-68075340 TGGTCAGACTTCTAACTGCGGGG - Intergenic
1027583960 7:80033785-80033807 TAGTCATATTTTTCACTGGTTGG + Intergenic
1028020455 7:85764962-85764984 TAGTCATCCTGTCAACTGCTTGG + Intergenic
1028078742 7:86548020-86548042 TAGTCTGAGTTTGAACTGCCAGG - Intergenic
1034380190 7:150685393-150685415 TAGACAAACTTCTAACTGTTGGG + Intergenic
1038193109 8:25342083-25342105 CAGTCTGACTTTGCACTGCTGGG - Intronic
1041458933 8:58090615-58090637 TACTCAGATTTTCAACTGCATGG + Intronic
1042369399 8:67973786-67973808 AAGTCAGACATTTTACAGCTGGG + Intronic
1045834810 8:106507453-106507475 TTCTCAGTCTTTTACCTGCTGGG - Intronic
1046795127 8:118363378-118363400 TATTCAGGCCTTTAACTGATTGG - Intronic
1047111206 8:121791357-121791379 TATTCAGACCTTTAAATGATTGG + Intergenic
1047198891 8:122746971-122746993 CACTCAGGCTTTTAACTGATTGG + Intergenic
1047980093 8:130171860-130171882 TACCCATACTTTTAACTCCTGGG - Intronic
1055333739 9:75210260-75210282 TACTCAGGCTTTCAACTGATTGG - Intergenic
1058460730 9:105180018-105180040 TATTCAGACCTTTAACTGACTGG - Intergenic
1058708446 9:107657320-107657342 TAGTCACACTATTGGCTGCTTGG + Intergenic
1059286203 9:113173809-113173831 TAGGCACACTTTTGTCTGCTTGG - Intronic
1185716343 X:2345734-2345756 TAGTCAGACCTTCAACTGATTGG - Intronic
1185818315 X:3177702-3177724 CAGTAAACCTTTTAACTGCTAGG + Intergenic
1186867060 X:13731047-13731069 TAGTTATACTTTTAAGTTCTAGG - Intronic
1187419787 X:19123758-19123780 CAGAGAGACTTTTAACTGATTGG + Intergenic
1187767243 X:22655849-22655871 TACTCACACCTTTAACTGATTGG + Intergenic
1188090193 X:25954238-25954260 TATTCAGCCCTTTAACTGATTGG + Intergenic
1188284628 X:28312857-28312879 TAGTATGACTTTTAACTTTTGGG + Intergenic
1189132126 X:38510689-38510711 AAGGCAGACTATTAAGTGCTGGG + Intronic
1189320029 X:40082293-40082315 TGTGCAGACTTTTAACTGATCGG - Intronic
1189602456 X:42641607-42641629 TGGTCAAACTTTTAGCTGGTTGG - Intergenic
1190408065 X:50107315-50107337 TATTCAGGCTTTCAACTGTTTGG + Intergenic
1197501294 X:127244740-127244762 TATTCAGGCTTTCAACTGTTTGG - Intergenic
1197642060 X:128977828-128977850 TAGTCAGGCTTTCAACTGATTGG - Intergenic
1198021822 X:132666316-132666338 TACTAAGACTGTGAACTGCTTGG + Intronic
1199693240 X:150325106-150325128 TATTCAGACCTTCAACTGATTGG + Intergenic
1200131177 X:153847535-153847557 TAGTAAGACTTTGATCTGCCGGG - Intergenic