ID: 1005690502

View in Genome Browser
Species Human (GRCh38)
Location 6:28300384-28300406
Sequence ATTGAGAAGACCTATGCAGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 173
Summary {0: 1, 1: 0, 2: 1, 3: 19, 4: 152}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1005690502_1005690507 -4 Left 1005690502 6:28300384-28300406 CCCTCTGCATAGGTCTTCTCAAT 0: 1
1: 0
2: 1
3: 19
4: 152
Right 1005690507 6:28300403-28300425 CAATGCAACTTGGGGCACCAAGG 0: 1
1: 0
2: 0
3: 5
4: 119
1005690502_1005690508 3 Left 1005690502 6:28300384-28300406 CCCTCTGCATAGGTCTTCTCAAT 0: 1
1: 0
2: 1
3: 19
4: 152
Right 1005690508 6:28300410-28300432 ACTTGGGGCACCAAGGAGCATGG 0: 1
1: 4
2: 34
3: 91
4: 312
1005690502_1005690509 4 Left 1005690502 6:28300384-28300406 CCCTCTGCATAGGTCTTCTCAAT 0: 1
1: 0
2: 1
3: 19
4: 152
Right 1005690509 6:28300411-28300433 CTTGGGGCACCAAGGAGCATGGG 0: 1
1: 5
2: 34
3: 111
4: 264
1005690502_1005690511 30 Left 1005690502 6:28300384-28300406 CCCTCTGCATAGGTCTTCTCAAT 0: 1
1: 0
2: 1
3: 19
4: 152
Right 1005690511 6:28300437-28300459 TCTGCATCCTGCTCCTAAAGAGG 0: 1
1: 0
2: 1
3: 8
4: 135

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1005690502 Original CRISPR ATTGAGAAGACCTATGCAGA GGG (reversed) Intronic
907662627 1:56407221-56407243 ATTGAGATGTCTTATTCAGATGG + Intergenic
908047762 1:60189998-60190020 TTTCAGAAGACAGATGCAGATGG + Intergenic
909686116 1:78350935-78350957 ATTGAGAAGAACAAAGCAGAAGG - Intronic
914793605 1:150901239-150901261 ATTGAAAAGACTTAAGCAAATGG + Intergenic
915029761 1:152868087-152868109 ATTGTGCAGACCTATGGGGAAGG + Intergenic
916933902 1:169607886-169607908 ATTCAGAAGGCCTATGAAGGGGG + Intronic
922413550 1:225398427-225398449 ATTGAGCCGACCGATCCAGAGGG - Intronic
1063547788 10:6999099-6999121 ACTGAGAAGCCATGTGCAGATGG - Intergenic
1063821083 10:9836784-9836806 TTTGTGAAGACACATGCAGATGG + Intergenic
1065301773 10:24328872-24328894 ATTGGGAAGACACATGCTGAAGG - Intronic
1065581600 10:27177165-27177187 ATTCAGGAGTGCTATGCAGAAGG - Intronic
1066596865 10:37060716-37060738 ATTGATTAGACCTATGCCTATGG - Intergenic
1070421722 10:76243989-76244011 ATGGAGAAGAGATATGAAGATGG + Intronic
1071133924 10:82431152-82431174 ATTGAGAAGCCCTATTCATAGGG - Intronic
1071404619 10:85318109-85318131 ATTGTCATGACCTTTGCAGAGGG - Intergenic
1071563635 10:86660649-86660671 TGTGAGAAGAGCTAGGCAGAGGG + Intronic
1071919815 10:90336774-90336796 ACTGAAAAGACCTAATCAGAAGG - Intergenic
1072057648 10:91776291-91776313 ATTGAGAAGACTTATATACAGGG + Intergenic
1077853597 11:6099654-6099676 ACTGACAGGAGCTATGCAGAGGG + Intergenic
1078676960 11:13429161-13429183 ATTAAGAAGACCTAAACAAATGG + Intronic
1084985793 11:72870086-72870108 AATGAGAAGGCCTTTACAGAGGG - Intronic
1085892749 11:80600412-80600434 ATTGATTAGACCTATGCATATGG + Intergenic
1086379757 11:86240156-86240178 GTTGATAAGACTTATACAGAAGG - Intergenic
1086742680 11:90387068-90387090 AATGAGAAAACCTATGCATTGGG + Intergenic
1087224006 11:95577712-95577734 ATTGAGAAGACCCATATCGAAGG - Intergenic
1087805247 11:102548379-102548401 ATTGAGAAGACGTATGTGCAGGG + Intergenic
1092118930 12:6030164-6030186 AATGAGAGGACCTCTGCAAAGGG - Intronic
1092142506 12:6193609-6193631 TTTGAGAAGAGCTATCCAGAGGG + Intergenic
1092685114 12:11034478-11034500 ATTGATAAGACATATGCAAATGG - Intronic
1092689805 12:11095394-11095416 ATTGATAAGACATATGCAAATGG - Intronic
1092693061 12:11136590-11136612 ATTGATAAGACATATGCAAATGG - Intronic
1096976452 12:55701834-55701856 AGAGAGAAGACTTCTGCAGAGGG - Intronic
1097812385 12:64033126-64033148 ATGGAGAACACATATGCAAAGGG - Intronic
1098723672 12:73934189-73934211 AATGAGTAGACCTATACAAAAGG + Intergenic
1100519575 12:95360651-95360673 ACTGTAAAGCCCTATGCAGAAGG - Intergenic
1100956961 12:99919384-99919406 ATTAATAATACCTATGAAGAAGG - Intronic
1101959085 12:109234748-109234770 ATTGAGAACACATGGGCAGAGGG + Intronic
1102640773 12:114364591-114364613 CTTGAGAAGACAGATACAGAAGG - Intronic
1103065056 12:117890633-117890655 AATGGGAAGACCTATGCATTTGG + Intronic
1104666075 12:130648467-130648489 ATTTAGAAGACGCATACAGATGG - Intronic
1105988838 13:25597471-25597493 TGTGAGAAGGCCTATGGAGAGGG + Intronic
1107433831 13:40364305-40364327 ATTGATAAGAACTATCCTGATGG + Intergenic
1107774879 13:43827909-43827931 AGAGAGAACACCTAGGCAGAGGG + Intronic
1107893411 13:44934040-44934062 ATTGGGAAGAGCTAAGGAGATGG - Intergenic
1110992780 13:82064970-82064992 ATTCAGAAGAAAAATGCAGAGGG + Intergenic
1111708866 13:91785771-91785793 ATTTAGAAGATCTGTGCAGATGG - Intronic
1114401149 14:22411922-22411944 GTTGAGAGGAGCTATGCATAAGG + Intergenic
1115248152 14:31317943-31317965 AGTGAAATGACCTATGCACAAGG + Intronic
1118345498 14:64937825-64937847 CTTGAGAAGCCCAATGCTGAAGG - Intronic
1119462533 14:74819925-74819947 ATTCAGATGATCTATACAGAGGG - Intronic
1122014155 14:98779280-98779302 AGCGAGAAGACCTGTGCAGATGG - Intergenic
1122385809 14:101346668-101346690 ATAAAGAAGACCTATGTAAATGG + Intergenic
1124005825 15:25794778-25794800 AGTGAGAAGGGCCATGCAGATGG + Intronic
1124984309 15:34591384-34591406 ATTTAGAAGATCTGTGCAGATGG - Intergenic
1125927186 15:43572463-43572485 ATTGTGGAGCCGTATGCAGAAGG + Intronic
1125940330 15:43672028-43672050 ATTGTGGAGCCGTATGCAGAAGG + Intergenic
1130121078 15:81048188-81048210 TTAGGGAAGAGCTATGCAGAGGG + Intronic
1131966666 15:97851522-97851544 ATTAGGAAGGCCTGTGCAGAAGG + Intergenic
1132785758 16:1656324-1656346 CTTGAGAAGACCCCTGCAGAAGG + Exonic
1134069234 16:11250366-11250388 ATGGAGATGATCTAAGCAGAGGG - Intronic
1136418960 16:30120576-30120598 AGTGAGAAGTCCTAAGAAGAAGG + Intronic
1138378479 16:56583626-56583648 ATTGATAACACCAATGCAGCAGG + Intergenic
1138459194 16:57138044-57138066 GCTGAGAAGTCCTATGCATAGGG - Intronic
1141527682 16:84622594-84622616 ATTGGGAAGGCCGAAGCAGAAGG + Intergenic
1143042149 17:4046560-4046582 ATTGAGGTTACATATGCAGAGGG - Intronic
1145893766 17:28438985-28439007 ATTGAGAAGAATTATAGAGATGG - Intergenic
1152274140 17:79344475-79344497 ATTGAGAAGCCCAATGAGGAAGG - Intronic
1154340019 18:13495121-13495143 ATTCAGAAGGGCTATGCAGCAGG + Intronic
1155793202 18:29999100-29999122 GTTGAGAAAACCAATGAAGACGG + Intergenic
1156404844 18:36773914-36773936 GTTGAGATAACCTAGGCAGAGGG + Intronic
1157231219 18:45917796-45917818 ATTGAGAAGTTCTGTGCAGAAGG - Exonic
1157331883 18:46710219-46710241 AGTGAGAAGACAAATGCAGAAGG + Intronic
1157456263 18:47831311-47831333 ATGGAGAAGACCTTTGAAGAAGG - Exonic
1158564500 18:58543229-58543251 ACTGAGAAGTCCCAGGCAGAGGG - Intronic
1159059029 18:63495136-63495158 TTTGAGAAGACCACTGCAGTTGG - Intronic
1159178912 18:64875502-64875524 ATTCAGAAGGCAAATGCAGAAGG + Intergenic
1159380420 18:67650236-67650258 ATTTATAAGAACTATGAAGATGG - Intergenic
1159387851 18:67749057-67749079 ATTCAAAAGACATATGCAGAAGG - Intergenic
1159698565 18:71592851-71592873 ATAGAGAAGACCTGTTGAGAAGG + Intergenic
1162431519 19:10631682-10631704 AATGAGACGACCTATGAGGATGG + Exonic
1166647495 19:44543025-44543047 ATTGAGAAGACCAGGCCAGAGGG + Intergenic
925476916 2:4227432-4227454 ATAGAGATAACCTATGCATAAGG + Intergenic
925645904 2:6036844-6036866 AGTGGGAAAACCCATGCAGATGG - Intergenic
927060797 2:19417338-19417360 ATTGAGAAGACATAGCCAGTTGG - Intergenic
928063233 2:28136220-28136242 ATTGAGAAGATCTAAGAACATGG - Intronic
928215071 2:29354555-29354577 ATTGAGAAGAAGGATGAAGAAGG - Intronic
930618739 2:53622750-53622772 ACTGATAAGGCCTATGTAGAAGG + Intronic
932109722 2:68986968-68986990 AGAGAGTAGACCTGTGCAGATGG + Intergenic
933278732 2:80309167-80309189 ATAGAGAAAACCTGTGGAGAGGG - Intronic
937067385 2:119028143-119028165 ACTGTGAAGAGCTTTGCAGATGG + Intergenic
937710521 2:124975533-124975555 ATTGAGATGCCCTAGGGAGAGGG - Intergenic
941132281 2:161667419-161667441 TATGATAAGACCTATGAAGAAGG + Intronic
942280590 2:174359436-174359458 TATGAGAAGACCTCTGCATAGGG + Intronic
942668023 2:178343039-178343061 ATGCAGAAGACTTATGAAGATGG + Intronic
942804432 2:179912994-179913016 AATGAGAAAACATATACAGAGGG - Intergenic
946148130 2:217746254-217746276 ATTGCTGAGACCTGTGCAGATGG - Intronic
1169138523 20:3212824-3212846 ATTCAGAAGGCCTATGAACATGG - Intronic
1175420056 20:58826090-58826112 ATTGAGAGCACTTATGCAGTTGG - Intergenic
1178940713 21:36902714-36902736 AATGAGAAGACGAATGCAGTGGG + Intronic
1182574983 22:31266905-31266927 TTTGAGAAAATCTATGCAGCTGG - Intronic
1183348520 22:37320944-37320966 ATGAAGAAGACCGAGGCAGAAGG + Intergenic
951115829 3:18861017-18861039 TTTGAGAAGAGCTTTGCAAATGG - Intergenic
953975252 3:47377333-47377355 ACAGAGAAGACCTATAGAGATGG - Intergenic
956897858 3:73682192-73682214 ATTGAGAAGTCCATTGCAGCTGG - Intergenic
963889446 3:150617489-150617511 ATTGAGGAGACTGAGGCAGAAGG + Intronic
965141668 3:164845146-164845168 ACTCAGAAGACCTATGCAGAAGG - Intergenic
974328404 4:60444888-60444910 TTGGAGAAGACATTTGCAGAGGG - Intergenic
974435972 4:61857547-61857569 ATTGAGAAGAACTTTGGAGGGGG + Intronic
976264391 4:83176471-83176493 CATGAGAAGAGGTATGCAGATGG + Intergenic
977224442 4:94378148-94378170 ATTTATAAGAGATATGCAGATGG + Intergenic
977759433 4:100714412-100714434 CTTGATAAGACATATGCAAAAGG - Intronic
979552685 4:122008982-122009004 ATTGAGAAGACCTATCTTCATGG - Intergenic
980218887 4:129888884-129888906 ATTGAGAACAGCTATGAAGAGGG + Intergenic
981272765 4:142863971-142863993 GATGAAAAGACTTATGCAGATGG - Intergenic
982267121 4:153548249-153548271 ATTGACAAGAATTAGGCAGATGG + Intronic
983867444 4:172785763-172785785 ATTGTAAAGTCTTATGCAGAAGG + Intronic
985753282 5:1695998-1696020 ATTGTGGAGACCTCAGCAGATGG - Intergenic
992055802 5:72988097-72988119 ATTGAGAAGAGCCAGGCAAAAGG + Intronic
992866967 5:80967512-80967534 ATTGTGAAGACCTGTGGTGATGG + Intronic
996859957 5:128054177-128054199 ACTGAGCAGACGAATGCAGAGGG - Intergenic
999615511 5:153418636-153418658 GTTGAGAAGACATATGCCAAAGG + Intergenic
1000104126 5:158042649-158042671 ATTGAGAAGCCTTAAGCAAATGG - Intergenic
1000238911 5:159390698-159390720 ATGGAGAAGAACTATGAAGTGGG + Intergenic
1002968833 6:1993443-1993465 ATGGACAACACCTCTGCAGAGGG + Intronic
1003995276 6:11534547-11534569 AATGAGAAGACCTGTGGAGCTGG + Intergenic
1005690502 6:28300384-28300406 ATTGAGAAGACCTATGCAGAGGG - Intronic
1009630768 6:66197553-66197575 ATAGAGTAGACCTATGAGGATGG - Intergenic
1009786714 6:68349710-68349732 TGTGAGAAGCCCTATGGAGAGGG + Intergenic
1011119804 6:83939489-83939511 TTTGAAAAGACCTATTAAGAAGG - Intronic
1012615685 6:101277001-101277023 ACAGAGAATACCTATGCAGCTGG - Intergenic
1012805117 6:103884148-103884170 ACTGAGAAGACTGAGGCAGAAGG - Intergenic
1017433847 6:154397243-154397265 ATTGAGGAGAAATCTGCAGAAGG + Exonic
1018096307 6:160390136-160390158 ATAGAGTAGCCCTATTCAGATGG + Intronic
1022909437 7:34885978-34886000 CCTGAGAAGACTAATGCAGATGG + Intergenic
1023158536 7:37275662-37275684 ATTGAGAAGGCACAGGCAGAAGG - Intronic
1024059427 7:45686829-45686851 ATGGAGGAGACCTATGCTGGGGG + Intronic
1026925463 7:74189364-74189386 AGTCAGAAGAGCTCTGCAGATGG + Intronic
1027618012 7:80448129-80448151 AGTGATAAGGCCTATGAAGAAGG + Intronic
1028474048 7:91234469-91234491 ATGGAGAAGGCGTCTGCAGAAGG - Intergenic
1028654637 7:93190481-93190503 ATTGAGAAGACAGAAGAAGAAGG + Intronic
1030437049 7:109535712-109535734 ATTGATAAGACCTGGGTAGAAGG - Intergenic
1031138067 7:117907538-117907560 AATGAGCAGACATATGCTGAGGG - Intergenic
1031440489 7:121788711-121788733 ATTGAGAACACATAAGCAGCTGG - Intergenic
1031977120 7:128101188-128101210 AGGGAGCAGAGCTATGCAGAGGG + Intergenic
1032737137 7:134702782-134702804 GTCGGGAAGACCCATGCAGAGGG - Intergenic
1036801833 8:11798301-11798323 CTTGGGAAGACCAATGCAGGCGG - Intronic
1036898418 8:12654150-12654172 ATTGAGAAGACATCTCCATATGG + Intergenic
1037586874 8:20283055-20283077 CTTGAGAAGAGCTCTGGAGAAGG + Intronic
1037860938 8:22405186-22405208 CTTCAGAACACCTATGCAGGGGG - Intronic
1038821229 8:30953640-30953662 CATGAGAAGACATAGGCAGAAGG + Intergenic
1038904272 8:31880547-31880569 ATTGAGAACACCTATGCACTGGG - Intronic
1040917496 8:52578301-52578323 ATTGAGAAGACCAGTGTAGCTGG - Intergenic
1041328842 8:56700440-56700462 AATGAGAAGATCAATGCATAGGG + Intergenic
1045958408 8:107937199-107937221 ATTGAGAATCCATACGCAGAAGG - Intronic
1046282025 8:112045753-112045775 TTTGAGAAGAGGTATACAGATGG - Intergenic
1052224133 9:26063988-26064010 AGCAGGAAGACCTATGCAGAGGG + Intergenic
1056446426 9:86670589-86670611 ATTTAGATGACCTATCCAAAAGG - Intergenic
1058749461 9:108025002-108025024 ATTGAGAAGTCCTATGTAAAGGG + Intergenic
1061296454 9:129679436-129679458 AATGAGATGATCCATGCAGAGGG - Intronic
1188571851 X:31596488-31596510 ATTGAGAAGACCTGGGCTGTTGG + Intronic
1189928176 X:45979194-45979216 TTTGAGAAAAACTATACAGATGG - Intergenic
1190268179 X:48841936-48841958 AATGAGAAGAGTTCTGCAGATGG + Intergenic
1192107548 X:68329927-68329949 ATTGAGAACACATATGTAAATGG + Intronic
1193414621 X:81206777-81206799 ATAGAGAAGACCTACACAGTTGG + Intronic
1194399020 X:93420306-93420328 AGAGTGAAGACCTATGCAGGTGG + Intergenic
1195086266 X:101417233-101417255 ATTGAGAAAACCAAGGCAGTAGG + Intergenic
1195110382 X:101641993-101642015 TTTGATTAGACCAATGCAGATGG - Intergenic
1197618504 X:128720768-128720790 TTTGAGAGGACCTAGGCAGATGG + Intergenic
1198569996 X:137944710-137944732 ATTGGGTAGACCTGAGCAGAGGG - Intergenic
1199006042 X:142697083-142697105 ATTGAGAAAAACTATTCAGGTGG - Intergenic
1199904483 X:152211063-152211085 GGTAAGAAGACCTATACAGATGG - Intronic
1200122374 X:153797268-153797290 GTAGGGAAGACCAATGCAGAGGG + Intronic
1202172532 Y:22066235-22066257 ATTCAGGAGACCAAGGCAGATGG + Intergenic