ID: 1005691465

View in Genome Browser
Species Human (GRCh38)
Location 6:28311090-28311112
Sequence CTGCTGTTGTGGAGGTGGCA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1005691456_1005691465 24 Left 1005691456 6:28311043-28311065 CCTGTAATGTGAAAGTCTTCAGG No data
Right 1005691465 6:28311090-28311112 CTGCTGTTGTGGAGGTGGCAGGG No data
1005691459_1005691465 -7 Left 1005691459 6:28311074-28311096 CCATGGATACAAGCACCTGCTGT No data
Right 1005691465 6:28311090-28311112 CTGCTGTTGTGGAGGTGGCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1005691465 Original CRISPR CTGCTGTTGTGGAGGTGGCA GGG Intergenic
No off target data available for this crispr