ID: 1005691611

View in Genome Browser
Species Human (GRCh38)
Location 6:28311984-28312006
Sequence GAGAAGGATTTGACTTTACT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1005691611_1005691618 15 Left 1005691611 6:28311984-28312006 CCAAGTAAAGTCAAATCCTTCTC No data
Right 1005691618 6:28312022-28312044 TCAGGTTCCCTAGTGACGGTGGG No data
1005691611_1005691617 14 Left 1005691611 6:28311984-28312006 CCAAGTAAAGTCAAATCCTTCTC No data
Right 1005691617 6:28312021-28312043 TTCAGGTTCCCTAGTGACGGTGG No data
1005691611_1005691623 25 Left 1005691611 6:28311984-28312006 CCAAGTAAAGTCAAATCCTTCTC No data
Right 1005691623 6:28312032-28312054 TAGTGACGGTGGGTGTTCAGGGG No data
1005691611_1005691622 24 Left 1005691611 6:28311984-28312006 CCAAGTAAAGTCAAATCCTTCTC No data
Right 1005691622 6:28312031-28312053 CTAGTGACGGTGGGTGTTCAGGG No data
1005691611_1005691621 23 Left 1005691611 6:28311984-28312006 CCAAGTAAAGTCAAATCCTTCTC No data
Right 1005691621 6:28312030-28312052 CCTAGTGACGGTGGGTGTTCAGG No data
1005691611_1005691615 11 Left 1005691611 6:28311984-28312006 CCAAGTAAAGTCAAATCCTTCTC No data
Right 1005691615 6:28312018-28312040 ACCTTCAGGTTCCCTAGTGACGG No data
1005691611_1005691614 -3 Left 1005691611 6:28311984-28312006 CCAAGTAAAGTCAAATCCTTCTC No data
Right 1005691614 6:28312004-28312026 CTCTTGTGATTTGGACCTTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1005691611 Original CRISPR GAGAAGGATTTGACTTTACT TGG (reversed) Intergenic
No off target data available for this crispr