ID: 1005691613

View in Genome Browser
Species Human (GRCh38)
Location 6:28312000-28312022
Sequence AAGGTCCAAATCACAAGAGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1005691613_1005691622 8 Left 1005691613 6:28312000-28312022 CCTTCTCTTGTGATTTGGACCTT No data
Right 1005691622 6:28312031-28312053 CTAGTGACGGTGGGTGTTCAGGG No data
1005691613_1005691615 -5 Left 1005691613 6:28312000-28312022 CCTTCTCTTGTGATTTGGACCTT No data
Right 1005691615 6:28312018-28312040 ACCTTCAGGTTCCCTAGTGACGG No data
1005691613_1005691621 7 Left 1005691613 6:28312000-28312022 CCTTCTCTTGTGATTTGGACCTT No data
Right 1005691621 6:28312030-28312052 CCTAGTGACGGTGGGTGTTCAGG No data
1005691613_1005691617 -2 Left 1005691613 6:28312000-28312022 CCTTCTCTTGTGATTTGGACCTT No data
Right 1005691617 6:28312021-28312043 TTCAGGTTCCCTAGTGACGGTGG No data
1005691613_1005691623 9 Left 1005691613 6:28312000-28312022 CCTTCTCTTGTGATTTGGACCTT No data
Right 1005691623 6:28312032-28312054 TAGTGACGGTGGGTGTTCAGGGG No data
1005691613_1005691618 -1 Left 1005691613 6:28312000-28312022 CCTTCTCTTGTGATTTGGACCTT No data
Right 1005691618 6:28312022-28312044 TCAGGTTCCCTAGTGACGGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1005691613 Original CRISPR AAGGTCCAAATCACAAGAGA AGG (reversed) Intergenic
No off target data available for this crispr