ID: 1005691617

View in Genome Browser
Species Human (GRCh38)
Location 6:28312021-28312043
Sequence TTCAGGTTCCCTAGTGACGG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1005691613_1005691617 -2 Left 1005691613 6:28312000-28312022 CCTTCTCTTGTGATTTGGACCTT No data
Right 1005691617 6:28312021-28312043 TTCAGGTTCCCTAGTGACGGTGG No data
1005691611_1005691617 14 Left 1005691611 6:28311984-28312006 CCAAGTAAAGTCAAATCCTTCTC No data
Right 1005691617 6:28312021-28312043 TTCAGGTTCCCTAGTGACGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1005691617 Original CRISPR TTCAGGTTCCCTAGTGACGG TGG Intergenic
No off target data available for this crispr