ID: 1005696130

View in Genome Browser
Species Human (GRCh38)
Location 6:28354442-28354464
Sequence GTGTGCCAAACCTATATATT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 106
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 98}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1005696130_1005696136 8 Left 1005696130 6:28354442-28354464 CCCAATATATAGGTTTGGCACAC 0: 1
1: 0
2: 0
3: 7
4: 98
Right 1005696136 6:28354473-28354495 CATATAAACTTTGGGCACCCAGG 0: 1
1: 1
2: 3
3: 8
4: 109
1005696130_1005696133 -1 Left 1005696130 6:28354442-28354464 CCCAATATATAGGTTTGGCACAC 0: 1
1: 0
2: 0
3: 7
4: 98
Right 1005696133 6:28354464-28354486 CAGGCCTGACATATAAACTTTGG No data
1005696130_1005696134 0 Left 1005696130 6:28354442-28354464 CCCAATATATAGGTTTGGCACAC 0: 1
1: 0
2: 0
3: 7
4: 98
Right 1005696134 6:28354465-28354487 AGGCCTGACATATAAACTTTGGG 0: 3
1: 2
2: 4
3: 18
4: 128
1005696130_1005696137 9 Left 1005696130 6:28354442-28354464 CCCAATATATAGGTTTGGCACAC 0: 1
1: 0
2: 0
3: 7
4: 98
Right 1005696137 6:28354474-28354496 ATATAAACTTTGGGCACCCAGGG No data
1005696130_1005696138 23 Left 1005696130 6:28354442-28354464 CCCAATATATAGGTTTGGCACAC 0: 1
1: 0
2: 0
3: 7
4: 98
Right 1005696138 6:28354488-28354510 CACCCAGGGCTGATACACACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1005696130 Original CRISPR GTGTGCCAAACCTATATATT GGG (reversed) Intronic
900931104 1:5738319-5738341 GTGTCCCAAAAGTATACATTTGG + Intergenic
905488307 1:38323377-38323399 GAGTTCCAAACCCATACATTCGG - Intergenic
917705271 1:177626580-177626602 GGGTGCCAAAACCATTTATTGGG + Intergenic
923239099 1:232063078-232063100 GTGTGCCACCCCTATAGCTTAGG - Intergenic
1064782071 10:18852810-18852832 GTATGCCAAACATATCTTTTTGG - Intergenic
1071919776 10:90336428-90336450 GTGAGGCAAGCCTTTATATTTGG + Intergenic
1072658052 10:97344505-97344527 GTGTGTCAAGCAAATATATTGGG - Intergenic
1075173746 10:120140339-120140361 GTGTGCTAAAGCGATATATGAGG + Intergenic
1078388346 11:10912797-10912819 GTGTGGAAAACCCATACATTTGG + Intergenic
1078574999 11:12493783-12493805 GTGTGGAAAACCCACATATTTGG - Intronic
1081006506 11:37750752-37750774 AAGTGCCAAAAATATATATTGGG + Intergenic
1083329325 11:61890393-61890415 GTGTGGCCAACCTAGAAATTTGG + Intronic
1087290411 11:96314752-96314774 CTGTGCCAAACATTTATATTGGG - Intronic
1088581967 11:111325384-111325406 TTGTGCCAAACCTCTGTATAAGG - Intergenic
1094212336 12:27905688-27905710 GTATGTCAAACAAATATATTTGG + Intergenic
1095712010 12:45299912-45299934 AGGTGCCAAACCTAAGTATTTGG + Intronic
1096832570 12:54325671-54325693 ATTTGACAAACCTATATAATAGG - Intronic
1097755205 12:63400306-63400328 GTGTGCCAAGCCTGTGTATCAGG + Intergenic
1097755232 12:63400530-63400552 GTGTGCCAAGCCTGTGTATCAGG + Intergenic
1098039900 12:66343201-66343223 GTGTGTTAAACCTACAGATTTGG + Exonic
1099636436 12:85219663-85219685 TAGTGCCAAACCTATATATAAGG - Intronic
1101986270 12:109449902-109449924 GTGTGAGAAACTTTTATATTAGG - Exonic
1105748858 13:23402808-23402830 ATCTGCAATACCTATATATTTGG - Intronic
1106018321 13:25890251-25890273 TTGTGCTAAAGATATATATTTGG - Intronic
1106724615 13:32471177-32471199 ATGTGCCAAACCTGTGTATCAGG + Intronic
1111161405 13:84399369-84399391 ATGTGCCAAACTTGTGTATTGGG + Intergenic
1112191574 13:97183429-97183451 GTTTGCCAAACCTGTATTTCAGG - Intergenic
1112962373 13:105142451-105142473 GTGTTCCATAACTATATTTTAGG - Intergenic
1120037567 14:79715417-79715439 TTCTGGCAAACCTATATTTTGGG + Intronic
1121056005 14:90853533-90853555 CTGTGCCCAACCTAAATTTTAGG - Exonic
1126876063 15:53042801-53042823 GTGTGCCAAGAATATATAGTGGG + Intergenic
1127326904 15:57904692-57904714 TTCTGACAAATCTATATATTGGG + Intergenic
1130624546 15:85500353-85500375 GTCTGACAAACCTATGAATTAGG + Intronic
1134479998 16:14611023-14611045 CTGTGCCAAAGCATTATATTAGG + Intronic
1139212770 16:65096619-65096641 ATATGCCAAATCTATATAGTTGG - Intronic
1144443474 17:15305038-15305060 GTGTGCAAAAACTACTTATTGGG + Intronic
1146157988 17:30540273-30540295 TTGTGCCATACTTATATAATGGG - Intergenic
1148183399 17:45623044-45623066 GTGTGTGTAACCTATATATCTGG + Intergenic
1155140720 18:23041998-23042020 GTGTGGAAAACCCACATATTTGG + Intergenic
1168168057 19:54567399-54567421 GTGTCCCAAACCTTTATATCAGG - Intergenic
926430015 2:12776082-12776104 CTTTGCCAATCCTATAAATTGGG - Intergenic
934944069 2:98523863-98523885 GAGGGTCAAACATATATATTTGG - Intronic
937638339 2:124183055-124183077 TTGTACCAACCCTTTATATTTGG + Intronic
937899659 2:127009282-127009304 GTGTGCCAAAACCATTTAATAGG - Intergenic
940651143 2:156441843-156441865 GTGTGGAAAACCCATACATTTGG + Intronic
941812848 2:169771236-169771258 CTGTGCCTGACCTAAATATTTGG - Intronic
943144910 2:184030960-184030982 GTGTTTTATACCTATATATTGGG + Intergenic
944386987 2:199178060-199178082 ATGTGCCAAAACAATATATTTGG + Intergenic
945678413 2:212883444-212883466 GTGTGGCACACATATATATCGGG + Intergenic
1177525463 21:22284940-22284962 CTGTGACAAATCTATATATAAGG - Intergenic
949304421 3:2623584-2623606 TTTTGTCAAACTTATATATTAGG + Intronic
952439066 3:33305451-33305473 GTGTGTCAATACTACATATTTGG + Intronic
959004282 3:101002171-101002193 AGGTGCCAAACATATACATTGGG - Intergenic
959412625 3:106044398-106044420 GTGTACCAAATCTAGACATTTGG - Intergenic
962208327 3:133454383-133454405 GTGGAACAAACCTACATATTTGG - Intronic
965444147 3:168753535-168753557 GTGTGGTAATCCTATATATTGGG - Intergenic
967159260 3:186720741-186720763 GTGTGCCAGGCCTATATGTTAGG - Intronic
973075479 4:45919726-45919748 GTGTGCCCAACTTTTAGATTAGG + Intergenic
973271067 4:48263776-48263798 GGGGGCAAAACCTATATCTTAGG - Intronic
976005157 4:80420987-80421009 TTGTGGCATAACTATATATTGGG + Intronic
979150214 4:117302657-117302679 GTGTGTTCAACCTAAATATTAGG + Intergenic
980091347 4:128446267-128446289 GTGTGCAAAACCCATGTACTTGG + Intergenic
981177264 4:141696200-141696222 GGGTGCCAAGAATATATATTGGG - Intronic
982405747 4:155018387-155018409 GTGTGCCAAACTTCACTATTTGG - Intergenic
982981562 4:162142923-162142945 GTGTGTCAAAGCAATGTATTAGG - Intronic
983393436 4:167163181-167163203 TTTTGCCAAACCTAAATTTTAGG + Intronic
984120870 4:175741591-175741613 GTGTGTAGAACCTATTTATTTGG - Intronic
984320513 4:178190072-178190094 GTGGGCCAAATATATAAATTTGG + Intergenic
987155949 5:15089828-15089850 CTGAGCCAAAAGTATATATTTGG + Intergenic
995635806 5:114188714-114188736 TAGTGCCAAAACTATAAATTGGG + Intergenic
995840504 5:116439273-116439295 GTGTGCCTAGCCTTTATTTTGGG + Intergenic
1004371601 6:15057435-15057457 CTGTGCCAAGCCTATTTGTTTGG - Intergenic
1005057647 6:21745001-21745023 ATGTGCAAGATCTATATATTAGG - Intergenic
1005460391 6:26063661-26063683 GTGTGCCTAGCCAATATATTAGG + Intergenic
1005696130 6:28354442-28354464 GTGTGCCAAACCTATATATTGGG - Intronic
1005884775 6:30088788-30088810 ATCTGCCAAACCTACATATATGG - Intergenic
1010907945 6:81515986-81516008 TTGTGCCAAACCAATATGATTGG + Intronic
1011220477 6:85049634-85049656 GTGTTGGAAACCTACATATTAGG + Intergenic
1015715386 6:136187140-136187162 ATGTGCCAAAGGTATTTATTTGG - Intronic
1018865205 6:167741765-167741787 GTTTGCCAAACATTTTTATTAGG + Intergenic
1020747197 7:12092483-12092505 ATGTGCCAAAGCTGTATAGTGGG + Intergenic
1021325124 7:19257131-19257153 GTGAGCCAAACTTGCATATTTGG + Intergenic
1024656466 7:51454894-51454916 GTGTGGGAAACCCACATATTTGG + Intergenic
1026436158 7:70400827-70400849 TTGACCCAAACCTATAGATTAGG - Intronic
1027161978 7:75809419-75809441 GTGTGGAAAACTTACATATTTGG + Intergenic
1028096970 7:86773026-86773048 ATGTAACAAACCTACATATTTGG - Intronic
1035811045 8:2491413-2491435 ATATGCCAAACATATATTTTGGG + Intergenic
1035979294 8:4351476-4351498 CTGTGCCAAATTTATAGATTAGG + Intronic
1037679477 8:21083719-21083741 GTTTCACAAATCTATATATTAGG - Intergenic
1040370623 8:46769006-46769028 GTCATCCAAACCTATTTATTTGG + Intergenic
1043574170 8:81638515-81638537 AAGTGCCAAAAATATATATTAGG + Intergenic
1044273187 8:90271105-90271127 GTTTCCCAAACCAATATATATGG + Intergenic
1045751806 8:105494141-105494163 GTGAGCTAAAGCTACATATTTGG - Intronic
1050049188 9:1580985-1581007 GTGGGCCAAAACTAATTATTTGG + Intergenic
1061672458 9:132196677-132196699 GTGTGGAAAACCCATACATTTGG - Intronic
1188645976 X:32567695-32567717 ATATGCAAAACCTATCTATTGGG - Intronic
1188819615 X:34758502-34758524 TTGTTCAAAACCTATATATGTGG - Intergenic
1188829400 X:34878000-34878022 ATGTGCCAAAACTATATACCTGG - Intergenic
1192280187 X:69676787-69676809 ATGAGCCCAACCTATTTATTTGG + Intronic
1192291362 X:69799069-69799091 GTGTGCCAAGAATATACATTGGG + Intronic
1194282820 X:91973978-91974000 TTTTGCAAAACCTTTATATTGGG + Intronic
1194621602 X:96179579-96179601 ATATGCCAAAAATATATATTTGG + Intergenic
1195248413 X:103018338-103018360 ATGTAACAAACCTATACATTTGG - Intergenic
1195773228 X:108374475-108374497 GTCAGCCAAACCTGTATTTTAGG - Intronic
1197741090 X:129894615-129894637 GTGTGCTACAACTACATATTTGG - Intergenic
1200600398 Y:5198511-5198533 TTTTGCAAAACCTTTATATTGGG + Intronic