ID: 1005696131

View in Genome Browser
Species Human (GRCh38)
Location 6:28354443-28354465
Sequence TGTGTGCCAAACCTATATAT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 103
Summary {0: 1, 1: 0, 2: 1, 3: 8, 4: 93}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1005696131_1005696133 -2 Left 1005696131 6:28354443-28354465 CCAATATATAGGTTTGGCACACA 0: 1
1: 0
2: 1
3: 8
4: 93
Right 1005696133 6:28354464-28354486 CAGGCCTGACATATAAACTTTGG No data
1005696131_1005696138 22 Left 1005696131 6:28354443-28354465 CCAATATATAGGTTTGGCACACA 0: 1
1: 0
2: 1
3: 8
4: 93
Right 1005696138 6:28354488-28354510 CACCCAGGGCTGATACACACAGG No data
1005696131_1005696137 8 Left 1005696131 6:28354443-28354465 CCAATATATAGGTTTGGCACACA 0: 1
1: 0
2: 1
3: 8
4: 93
Right 1005696137 6:28354474-28354496 ATATAAACTTTGGGCACCCAGGG No data
1005696131_1005696136 7 Left 1005696131 6:28354443-28354465 CCAATATATAGGTTTGGCACACA 0: 1
1: 0
2: 1
3: 8
4: 93
Right 1005696136 6:28354473-28354495 CATATAAACTTTGGGCACCCAGG 0: 1
1: 1
2: 3
3: 8
4: 109
1005696131_1005696134 -1 Left 1005696131 6:28354443-28354465 CCAATATATAGGTTTGGCACACA 0: 1
1: 0
2: 1
3: 8
4: 93
Right 1005696134 6:28354465-28354487 AGGCCTGACATATAAACTTTGGG 0: 3
1: 2
2: 4
3: 18
4: 128

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1005696131 Original CRISPR TGTGTGCCAAACCTATATAT TGG (reversed) Intronic
906321471 1:44820083-44820105 TGTGTGCATAAACTACATATAGG - Intronic
909969194 1:81959162-81959184 TGACTGCCAATCCTAAATATTGG - Intronic
914442418 1:147719053-147719075 TATGTGCCAAACCCGTGTATTGG + Intergenic
916349960 1:163837889-163837911 TTTTTGCCAAACCTATATGAAGG - Intergenic
917673879 1:177300994-177301016 TGTGTGCCAACCCTGGAGATGGG + Intergenic
921608314 1:217180596-217180618 TGTCTGCCAAACCTACAAAAGGG + Intergenic
922151900 1:223013602-223013624 TGTGTGCCACGTCTATGTATGGG + Intergenic
922901130 1:229137509-229137531 TGTGACCCTAACCTAGATATGGG - Intergenic
1072423023 10:95305485-95305507 GCTCTGCCAAACATATATATAGG - Intergenic
1072658053 10:97344506-97344528 TGTGTGTCAAGCAAATATATTGG - Intergenic
1077936536 11:6794026-6794048 TGTGTGTCATGCCTATATGTGGG - Intergenic
1079765287 11:24384566-24384588 TGTGTGCCAACTCTAGGTATTGG - Intergenic
1087290412 11:96314753-96314775 TCTGTGCCAAACATTTATATTGG - Intronic
1087334495 11:96826242-96826264 TGTGTGCCTAGCCTGTATAAAGG + Intergenic
1087500033 11:98939148-98939170 TGTGGGCAAAACCTAAATTTTGG + Intergenic
1087739311 11:101869612-101869634 TGTTTCCCAAGCCTAAATATGGG - Intronic
1092215955 12:6682865-6682887 TGTCTGCAAAATCTATATGTAGG - Intronic
1100076712 12:90793865-90793887 TGTGTGACAAAAATATATCTTGG + Intergenic
1100252831 12:92847311-92847333 TTTTTACCAAACCTAAATATTGG - Intronic
1106184657 13:27398811-27398833 TGTATGCCAAAAATACATATGGG - Intergenic
1106870633 13:34014940-34014962 TGTCTGACAAAGCCATATATTGG - Intergenic
1107118600 13:36774272-36774294 TGTATGCCAAAACTTTATCTGGG - Intergenic
1107658687 13:42616989-42617011 TGTGTGCCAATCCTGTTAATGGG + Intergenic
1107919592 13:45190346-45190368 AGTGAGGCAAACCTATATTTTGG + Intronic
1111161404 13:84399368-84399390 TATGTGCCAAACTTGTGTATTGG + Intergenic
1111625563 13:90780472-90780494 GCTATACCAAACCTATATATGGG + Intergenic
1111817956 13:93178299-93178321 TTTGTGCCAACCTAATATATAGG - Intergenic
1112204142 13:97307325-97307347 TGTGTGCCAAAGCCTTAAATTGG + Intronic
1117048510 14:51837235-51837257 TGTTTCCCATACCTAGATATAGG + Intronic
1119323281 14:73744080-73744102 TGTCTGCAAAACATATATGTGGG - Intronic
1119864896 14:77965378-77965400 TGTGGGCCAAACCTATGAATAGG - Intergenic
1122171173 14:99876882-99876904 TGTGTACCAAACTTTTGTATAGG + Intronic
1127326903 15:57904691-57904713 TTTCTGACAAATCTATATATTGG + Intergenic
1129224244 15:74157496-74157518 TGTTTGCAAAACCTCTCTATGGG - Intergenic
1131169750 15:90169364-90169386 TGTATGTCAAAACTATATACAGG - Intronic
1134125157 16:11611337-11611359 TGTCTGCAAAACATATATATAGG + Intronic
1136708180 16:32207950-32207972 TGTGTGCAGAACATACATATAGG + Intergenic
1136759728 16:32721456-32721478 TGTGTGCAGAACATACATATAGG - Intergenic
1136808376 16:33148930-33148952 TGTGTGCAGAACATACATATAGG + Intergenic
1137274047 16:46921910-46921932 TGTGTGCCACACCTGTGTGTAGG - Intronic
1137351381 16:47716821-47716843 TTTGGGCCAAACCAATGTATTGG + Intergenic
1141030697 16:80585675-80585697 TGTGTGCCAATCTGAAATATTGG - Intergenic
1141157873 16:81609756-81609778 TGTGTGCAAAGCCTGAATATGGG + Intronic
1203061882 16_KI270728v1_random:981767-981789 TGTGTGCAGAACATACATATAGG - Intergenic
1143360659 17:6366704-6366726 TGTGTGCCTATCCTATTTCTGGG - Intergenic
1145882866 17:28364746-28364768 TGTGGGCCAAGCCTAGATGTTGG + Intronic
1166590224 19:43991236-43991258 GATGTGTCGAACCTATATATGGG + Intronic
931100370 2:58992875-58992897 TGTCTGCAAAACCTGTTTATTGG - Intergenic
937861003 2:126709132-126709154 TGTGTGCCAAAAATATATGGAGG + Intergenic
939452676 2:142394466-142394488 TTGTTGCCAAACCTATGTATGGG + Intergenic
941880880 2:170478870-170478892 TGTATGTAAAACCTATATATGGG - Intronic
944019742 2:195087802-195087824 TGTTTCCCATACATATATATGGG + Intergenic
945460129 2:210097699-210097721 TCTGTGCCTAAACTATATCTAGG + Intronic
945678412 2:212883443-212883465 AGTGTGGCACACATATATATCGG + Intergenic
1169328165 20:4693813-4693835 TGTGAGCCACAGCTATATATAGG - Intronic
1172491611 20:35343415-35343437 TGTGTGTACAACCTATAAATGGG - Intronic
1181941510 22:26481259-26481281 TGTTTGCTAAACCTAATTATGGG + Intronic
954153659 3:48672736-48672758 TGTGTGTGAAGCCTATATAGTGG + Intergenic
957149364 3:76465064-76465086 TGTGTGCCAAACATTAATCTAGG - Intronic
959733144 3:109627322-109627344 TGTGGCCCAAATCTCTATATAGG + Intergenic
964340152 3:155699767-155699789 TGTGTGTCAGTCCTAGATATTGG + Intronic
965444148 3:168753536-168753558 TGTGTGGTAATCCTATATATTGG - Intergenic
966361732 3:179137346-179137368 TAAAGGCCAAACCTATATATAGG + Intergenic
969310655 4:6351449-6351471 TGTGTCCCCAGCCTATACATGGG - Intronic
976005156 4:80420986-80421008 TTTGTGGCATAACTATATATTGG + Intronic
976793888 4:88911033-88911055 TATGTGCCAAACCTAGTTGTAGG - Intronic
982469109 4:155765142-155765164 TGTTTGCCAAAACTAGATCTGGG - Intronic
983146399 4:164220456-164220478 TATATTCCATACCTATATATAGG - Intronic
986955140 5:13141175-13141197 TGTGTGCCTAAACTATGTTTAGG + Intergenic
986955145 5:13141306-13141328 TGTGTGCCTAAACTATGTTTAGG - Intergenic
989129275 5:38089091-38089113 TTTGTGCAAGACCTGTATATTGG + Intergenic
993321887 5:86480549-86480571 TGTGAGCCAAAAATATAAATGGG - Intergenic
995840503 5:116439272-116439294 TGTGTGCCTAGCCTTTATTTTGG + Intergenic
996170703 5:120287022-120287044 TGTGTGCCAAAACTACATAGAGG - Intergenic
1000530958 5:162419289-162419311 TGTCTGAGAAACATATATATAGG + Intergenic
1004299102 6:14441050-14441072 TCTGGGCCAAATCTATTTATAGG + Intergenic
1005441975 6:25879802-25879824 TAAGGGCCAAACCTATTTATTGG + Intronic
1005696131 6:28354443-28354465 TGTGTGCCAAACCTATATATTGG - Intronic
1005698407 6:28373534-28373556 TTTGTGTCAAACCTAAACATAGG + Intergenic
1005913151 6:30327868-30327890 TGTGTGCCAACAATATATACAGG + Intronic
1006637880 6:35473569-35473591 TGTGTGCCAGACCTTTGGATTGG - Intergenic
1007828475 6:44619756-44619778 TCTGTGCCATACCTATGGATTGG + Intergenic
1010701813 6:79058256-79058278 TTTTTGCCATACGTATATATAGG + Intronic
1010873908 6:81077495-81077517 TCAGTGCAAAATCTATATATAGG - Intergenic
1018189562 6:161298532-161298554 TCTGTGCTAAAACTATAGATGGG + Intergenic
1020196274 7:6041857-6041879 ATTGTGCCAGACCTATACATTGG - Intronic
1020747196 7:12092482-12092504 TATGTGCCAAAGCTGTATAGTGG + Intergenic
1030220358 7:107092141-107092163 TCTGATCCAAACCTATATTTAGG - Intronic
1032029623 7:128472033-128472055 TGTGTGCCAGACCTAGTTCTAGG + Intergenic
1032487856 7:132301467-132301489 TTTGTGCCACACCTATAAAGGGG - Intronic
1043013850 8:74913268-74913290 TGTTTACTAAACCTATACATAGG - Intergenic
1046875289 8:119248422-119248444 TGTGAGTCAAACCTATATCAGGG - Intergenic
1050739488 9:8803844-8803866 CATGTGCAAAACCTATTTATTGG + Intronic
1052248464 9:26367984-26368006 TGAATGCCAAACCTATACAGAGG - Intergenic
1054074815 9:60518742-60518764 TGTTTTGCAAACCTATATGTGGG + Intergenic
1057870451 9:98712798-98712820 TTTGTACCAAACTAATATATAGG + Intergenic
1058335780 9:103826763-103826785 TGTTAGCCAAACCAACATATTGG - Intergenic
1185977597 X:4738952-4738974 TGTGGACTAAACCTATATTTAGG - Intergenic
1193330188 X:80227231-80227253 TGTGTGGAAAAACTACATATAGG - Intergenic
1194416728 X:93621542-93621564 TTTGTGCCAAACCTAGATATAGG - Intergenic
1194630983 X:96283488-96283510 AGTCTGTCAAATCTATATATTGG - Intergenic
1197697211 X:129563277-129563299 TGTATGCATAAGCTATATATTGG + Intronic
1199201120 X:145090440-145090462 TGTGTGTCAAACCTGTGTATGGG - Intergenic