ID: 1005696135

View in Genome Browser
Species Human (GRCh38)
Location 6:28354468-28354490
Sequence GTGCCCAAAGTTTATATGTC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 127
Summary {0: 2, 1: 2, 2: 7, 3: 13, 4: 103}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1005696135_1005696141 23 Left 1005696135 6:28354468-28354490 CCTGACATATAAACTTTGGGCAC 0: 2
1: 2
2: 7
3: 13
4: 103
Right 1005696141 6:28354514-28354536 GACACATAAGTCTGACACATAGG No data
1005696135_1005696142 29 Left 1005696135 6:28354468-28354490 CCTGACATATAAACTTTGGGCAC 0: 2
1: 2
2: 7
3: 13
4: 103
Right 1005696142 6:28354520-28354542 TAAGTCTGACACATAGGCTCTGG 0: 1
1: 1
2: 6
3: 19
4: 108
1005696135_1005696143 30 Left 1005696135 6:28354468-28354490 CCTGACATATAAACTTTGGGCAC 0: 2
1: 2
2: 7
3: 13
4: 103
Right 1005696143 6:28354521-28354543 AAGTCTGACACATAGGCTCTGGG No data
1005696135_1005696138 -3 Left 1005696135 6:28354468-28354490 CCTGACATATAAACTTTGGGCAC 0: 2
1: 2
2: 7
3: 13
4: 103
Right 1005696138 6:28354488-28354510 CACCCAGGGCTGATACACACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1005696135 Original CRISPR GTGCCCAAAGTTTATATGTC AGG (reversed) Intronic
902854325 1:19189356-19189378 TTCCCAAAAGTTTATATTTCAGG + Intronic
911462040 1:98203348-98203370 GAGCCCAAAGCCTATATGTTTGG + Intergenic
913559683 1:120005087-120005109 CTGCTTAAAGTATATATGTCAGG - Intronic
913638177 1:120785453-120785475 CTGCTTAAAGTATATATGTCAGG + Intergenic
914280271 1:146164509-146164531 CTGCTTAAAGTATATATGTCAGG - Intronic
914541316 1:148615449-148615471 CTGCTTAAAGTATATATGTCAGG - Intronic
914625324 1:149455797-149455819 CTGCTTAAAGTATATATGTCAGG + Intergenic
914783820 1:150809975-150809997 GTGCCTTATGTTTGTATGTCTGG + Exonic
920609234 1:207421526-207421548 ATGCCCAAAGTTTATATATCAGG - Intergenic
920609240 1:207421586-207421608 GTGCCCAATGCTTATGGGTCAGG - Intergenic
921478581 1:215637661-215637683 GTTTCCAAACTTTACATGTCTGG - Intronic
1065311051 10:24416221-24416243 GTATCCAAAGTTTATATATTGGG - Intronic
1068438124 10:57017295-57017317 GTGCCCAAAGCTTATGTGTCAGG + Intergenic
1072607130 10:96994063-96994085 GTGCCCAATTTTGATGTGTCTGG - Intergenic
1073580251 10:104659311-104659333 TTGCCCACATTTTCTATGTCAGG - Intronic
1078661050 11:13286018-13286040 GTTCCAAAAGTTTATTTGTAAGG + Intronic
1079447688 11:20571548-20571570 GAGCAGAAAGTATATATGTCAGG - Intergenic
1080154358 11:29091222-29091244 TTTCCCAAATTTTATTTGTCTGG + Intergenic
1081017888 11:37906400-37906422 GTGCCCAAAGTTTATCTGTCAGG - Intergenic
1083821236 11:65172539-65172561 GTGCCCAAAGCTTATCCCTCTGG - Exonic
1086584118 11:88432343-88432365 GTGCCCAAAGCTTATGTGTCAGG - Intergenic
1087174339 11:95082372-95082394 GTGTCCAAAGTTTTTAATTCAGG + Intergenic
1087863988 11:103200707-103200729 GTGCCCACATTTCATGTGTCTGG + Intronic
1087962496 11:104369127-104369149 GTGCCCAAAGATTCATTGTCTGG - Intergenic
1088433089 11:109779892-109779914 GGGCCCTAATTTTATATGACTGG + Intergenic
1089223979 11:116900061-116900083 ATACCCCAAATTTATATGTCTGG + Intronic
1090562915 11:127952143-127952165 GTGGCCTTGGTTTATATGTCAGG - Intergenic
1091536260 12:1412929-1412951 GTGCCCTCATTTTATAGGTCAGG + Intronic
1093208018 12:16274158-16274180 GTGCACAAAACTTATGTGTCAGG - Intronic
1093927441 12:24923064-24923086 GTGCCCAAGGTTTTTATGTGGGG + Intronic
1104426684 12:128683624-128683646 GTTCTCAGAGTTTATATGTGTGG - Intronic
1106724619 13:32471205-32471227 ATGCCCAAAGCTTATGTGTCAGG + Intronic
1107557549 13:41530399-41530421 GTGCCCGCAGATTCTATGTCTGG - Intergenic
1110453394 13:75662636-75662658 GTGCCAAAAGTTTTTCTGTGTGG + Intronic
1112224238 13:97522350-97522372 GTGTCCAGGGTTTATATGTGGGG - Intergenic
1118153091 14:63210774-63210796 GTGTACATGGTTTATATGTCGGG + Intronic
1119919524 14:78433462-78433484 TCCCCCAAAGTTTATATGTTGGG + Intronic
1121459030 14:94059410-94059432 GTGCCCAAGGTTTCTCTGCCTGG - Intronic
1121648705 14:95539358-95539380 GTGACTAAAGTTTATTTATCTGG - Intronic
1126954178 15:53914115-53914137 GTGCCCAAAGCTTATATGCCAGG + Intergenic
1132263272 15:100444258-100444280 GAGCAGAAAGTATATATGTCAGG - Intronic
1132340650 15:101076297-101076319 GAGCAGAAAGTATATATGTCAGG - Intronic
1136990469 16:35148564-35148586 GAGCCCAAAGTGGATATGTGCGG + Intergenic
1139330650 16:66187202-66187224 GTGCCAACAGTTTATCTGTGAGG + Intergenic
1146085566 17:29825269-29825291 GTACCCAAAGGTTAAATGACAGG + Intronic
1149123899 17:53204541-53204563 ATCCCCAAGTTTTATATGTCAGG + Intergenic
1149910109 17:60559154-60559176 ATGCCCAAAGTTTATATGTCAGG - Intergenic
1149910116 17:60559212-60559234 GTGCCCAAGGCTTGTGTGTCAGG - Intergenic
1155941772 18:31807556-31807578 GAGCAGAAAGTATATATGTCAGG - Intergenic
1158200982 18:54940048-54940070 GTTCCCAATGTTTAGATATCAGG - Intronic
1158680365 18:59561256-59561278 ATGCCCAAAGCTTATGTGTCAGG + Intronic
1159013760 18:63084175-63084197 GTGCTCAAAGTCTAGATGGCAGG - Intergenic
1163200441 19:15763687-15763709 GTGACCACTGTTTATATGTGTGG - Intergenic
938823949 2:134986099-134986121 GTACCCAATATTGATATGTCTGG + Exonic
940178360 2:150904277-150904299 GTCTGCAAAGTTTAGATGTCAGG - Intergenic
942738344 2:179142230-179142252 GTCCACAAAGTCTAAATGTCTGG + Intronic
943033126 2:182709329-182709351 GTTCCTAAAGTTATTATGTCTGG - Intergenic
947802471 2:232938832-232938854 GTGCACATAATTTAGATGTCAGG + Intronic
1169418418 20:5438385-5438407 GTGCCTAAAGTTTATTTCCCAGG - Intergenic
1173627726 20:44485967-44485989 TTGCCCAAAGTATATTTCTCAGG - Intronic
1174529708 20:51201245-51201267 GTTCTTAAAGTTTATATGTATGG + Intergenic
1177700300 21:24631233-24631255 GTACTCAAAGTTTAAAGGTCAGG + Intergenic
1183865870 22:40703814-40703836 GTGCCCAAAGTCCATTTGTCTGG - Intergenic
1184061658 22:42086443-42086465 CTGGGCAAAGTTTCTATGTCTGG + Intronic
955497100 3:59545073-59545095 GTGCCCAAATTCAATATGACTGG + Intergenic
959126600 3:102297154-102297176 GTGCCCTAATTTTATAGGTGAGG - Intronic
962304563 3:134273974-134273996 GTCCCCAAAGTCCATATGTTGGG - Intergenic
965356015 3:167673720-167673742 GTGCCCAAAAATTTTATGTGAGG + Intergenic
965746311 3:171929472-171929494 GTGCCCATAGTTTGGATATCTGG - Intronic
973168941 4:47114393-47114415 GTGCCCAACCTTGATATGTAGGG - Intronic
973561850 4:52144816-52144838 GTGCCTAAAATTTGTATCTCAGG - Intergenic
974718215 4:65699405-65699427 GTGCCCAAAGTTTATATGCAAGG + Intergenic
974845152 4:67342910-67342932 GTGCTAAAAGTTTCTCTGTCAGG + Intergenic
975081455 4:70285420-70285442 CTGTCCAAAGTCTATAAGTCAGG + Intergenic
976002742 4:80391660-80391682 GTGCCATAATTTTATATGACTGG - Intronic
976392480 4:84519552-84519574 GTGCCATAAATGTATATGTCAGG - Intergenic
979157135 4:117409878-117409900 GTACCTCAAGTTTAAATGTCTGG + Intergenic
979531680 4:121774860-121774882 GTGCCCTCAGATTATGTGTCTGG - Intergenic
979747654 4:124237696-124237718 GTTTCCAAAGTATATCTGTCAGG - Intergenic
983685055 4:170398423-170398445 GTCTCCAAAGTTTGCATGTCTGG + Intergenic
983903034 4:173156896-173156918 GTGCCAAAAGTTTAGGTGTGGGG + Intergenic
987856425 5:23425005-23425027 GTTCCCAGAGCTTATGTGTCAGG + Intergenic
989699035 5:44239745-44239767 CTGACCAAAGTTTATTAGTCGGG - Intergenic
990920167 5:60955410-60955432 GTTCCAATAGTTTATATGTCTGG + Intronic
993660729 5:90631012-90631034 GTGCTGAAAGTATATATGTAAGG + Intronic
994788124 5:104188983-104189005 GTGCCCAGAGCTTATGTGTCAGG + Intergenic
999827242 5:155285537-155285559 GTGCCCAAAATTTCTATGGAGGG + Intergenic
1005231769 6:23709785-23709807 GTGCCCAAACCTCATTTGTCTGG - Intergenic
1005501047 6:26429509-26429531 ATTCCCCAAGTTAATATGTCTGG - Intergenic
1005505625 6:26466812-26466834 ATTCCCCAAGTTAATATGTCTGG - Intronic
1005661461 6:28002947-28002969 GTGCCCAAAGCCTATGTGTCAGG + Intergenic
1005696135 6:28354468-28354490 GTGCCCAAAGTTTATATGTCAGG - Intronic
1005696150 6:28354584-28354606 GTGCCCAGAGCTTATGTGTCAGG - Intronic
1009651079 6:66479176-66479198 GTTCCCAGAGCTTATGTGTCAGG - Intergenic
1009681407 6:66897513-66897535 GTGCCCAGAGTTTATGTGTCAGG + Intergenic
1012113597 6:95264660-95264682 TTTCCCAAAGTTTAAATGACAGG - Intergenic
1012880617 6:104783539-104783561 GTGCCCAAAGTTCACATAGCTGG + Intronic
1014913780 6:127120799-127120821 GAGCCCAAACTAAATATGTCAGG + Intronic
1017327112 6:153152265-153152287 ATGCCCAAAGTTGATATGTCAGG + Intergenic
1027659984 7:80977124-80977146 GTGCCCAGAGTTTTTATGGGAGG - Intergenic
1030303818 7:108000945-108000967 GGGCCCAAATTTTAGATTTCAGG - Intronic
1030797952 7:113813150-113813172 ATGACCAAAGTTTATATGCTGGG + Intergenic
1031603849 7:123746852-123746874 CTGCCTAAAGTTAATGTGTCTGG + Intronic
1033018537 7:137697634-137697656 GTGCTGATAGTTTATATTTCTGG - Intronic
1039601291 8:38840410-38840432 GTGCCCACAGATGAGATGTCTGG + Intronic
1046540393 8:115573437-115573459 GTTAGCAAAGTTTATATGTGCGG - Intronic
1046910100 8:119617165-119617187 GTGGCCAAAGTGTATAAGTTAGG + Exonic
1047058003 8:121189388-121189410 GTGACCAAAGTTCATATTTGTGG - Intergenic
1047560655 8:125984731-125984753 GGGCCCAAAGTTTATGTGTTGGG - Intergenic
1050589430 9:7147338-7147360 CTGCCCTGTGTTTATATGTCCGG - Intergenic
1050797007 9:9558478-9558500 GTACCCAAAGTTTGTATGGCAGG - Intronic
1050841376 9:10153443-10153465 ATGCCCAAAGTGTAAATGTCTGG - Intronic
1052569428 9:30200771-30200793 GTGCCCAGAGCTTATGTGTCAGG + Intergenic
1052569433 9:30200831-30200853 GTGCCCAGAGCCTATGTGTCAGG + Intergenic
1053377296 9:37618480-37618502 GTGCCCAAAGTTGTTTTGTATGG - Intronic
1056799857 9:89683503-89683525 GTGGGCCAAGTATATATGTCTGG - Intergenic
1056920935 9:90788817-90788839 GGGCACAAAGATTATTTGTCTGG + Intergenic
1060462134 9:123866383-123866405 GTGCCCAAAGTGTGTTTTTCTGG + Intronic
1186135893 X:6520299-6520321 ATGCCCAATGTTTATATATTGGG + Intergenic
1187476344 X:19614290-19614312 GTGCCCACAGGTTGTATGTCAGG - Intronic
1189122083 X:38405488-38405510 GGGCCTAAATTTAATATGTCTGG - Intronic
1191825838 X:65363864-65363886 GAGCACAAAGTATATGTGTCAGG - Intergenic
1192779286 X:74277780-74277802 GTGCCCATTGTTTCTATATCAGG - Intergenic
1194564883 X:95473094-95473116 TAGCCCAAACTTTAAATGTCTGG + Intergenic
1196017264 X:110953348-110953370 ATGCCCTCATTTTATATGTCAGG - Intronic
1196882171 X:120208347-120208369 ATGCCCAAAGCTTGTGTGTCAGG + Intergenic
1196882177 X:120208405-120208427 GTGCCCAAAGTTTATATGTCAGG + Intergenic