ID: 1005696138

View in Genome Browser
Species Human (GRCh38)
Location 6:28354488-28354510
Sequence CACCCAGGGCTGATACACAC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1005696131_1005696138 22 Left 1005696131 6:28354443-28354465 CCAATATATAGGTTTGGCACACA 0: 1
1: 0
2: 1
3: 8
4: 93
Right 1005696138 6:28354488-28354510 CACCCAGGGCTGATACACACAGG No data
1005696135_1005696138 -3 Left 1005696135 6:28354468-28354490 CCTGACATATAAACTTTGGGCAC 0: 2
1: 2
2: 7
3: 13
4: 103
Right 1005696138 6:28354488-28354510 CACCCAGGGCTGATACACACAGG No data
1005696130_1005696138 23 Left 1005696130 6:28354442-28354464 CCCAATATATAGGTTTGGCACAC 0: 1
1: 0
2: 0
3: 7
4: 98
Right 1005696138 6:28354488-28354510 CACCCAGGGCTGATACACACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1005696138 Original CRISPR CACCCAGGGCTGATACACAC AGG Intronic
No off target data available for this crispr