ID: 1005696368

View in Genome Browser
Species Human (GRCh38)
Location 6:28356116-28356138
Sequence CCAAAGGCAATATGTGGACT CGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 211
Summary {0: 1, 1: 0, 2: 3, 3: 22, 4: 185}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1005696368_1005696375 9 Left 1005696368 6:28356116-28356138 CCGAGTCCACATATTGCCTTTGG 0: 1
1: 0
2: 3
3: 22
4: 185
Right 1005696375 6:28356148-28356170 GTCCCCCCAAGCCTGGCACCTGG 0: 1
1: 0
2: 2
3: 29
4: 254
1005696368_1005696376 10 Left 1005696368 6:28356116-28356138 CCGAGTCCACATATTGCCTTTGG 0: 1
1: 0
2: 3
3: 22
4: 185
Right 1005696376 6:28356149-28356171 TCCCCCCAAGCCTGGCACCTGGG 0: 1
1: 5
2: 6
3: 46
4: 315
1005696368_1005696373 2 Left 1005696368 6:28356116-28356138 CCGAGTCCACATATTGCCTTTGG 0: 1
1: 0
2: 3
3: 22
4: 185
Right 1005696373 6:28356141-28356163 GTCCGGTGTCCCCCCAAGCCTGG 0: 1
1: 0
2: 12
3: 14
4: 95
1005696368_1005696384 30 Left 1005696368 6:28356116-28356138 CCGAGTCCACATATTGCCTTTGG 0: 1
1: 0
2: 3
3: 22
4: 185
Right 1005696384 6:28356169-28356191 GGGTCAGTTCCCAATCAAACAGG 0: 1
1: 0
2: 0
3: 0
4: 82

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1005696368 Original CRISPR CCAAAGGCAATATGTGGACT CGG (reversed) Exonic
900144189 1:1150831-1150853 CCAGAGGGAATCTGGGGACTTGG - Intergenic
900856502 1:5189564-5189586 CCAAGGCCGATAAGTGGACTTGG - Intergenic
902079202 1:13809613-13809635 TCAAAGGCCAGATGTGGGCTGGG + Intronic
902468469 1:16631942-16631964 CCAAAGGCAGCATCTGGACCTGG + Intergenic
903397325 1:23011764-23011786 CCAAAGGCAAGTGGAGGACTCGG - Intronic
903898756 1:26626931-26626953 CTAAAGGCAGTATGTGATCTTGG + Intergenic
904484816 1:30817738-30817760 CCAAATGCCACAGGTGGACTTGG - Intergenic
907149379 1:52269104-52269126 CCTAATGTAAAATGTGGACTTGG - Intronic
908097208 1:60751487-60751509 CCAAATGCATTAAGTGGCCTTGG - Intergenic
908734680 1:67263613-67263635 CCAAATGCAATCTGTTGGCTAGG + Intergenic
909174577 1:72339980-72340002 AAAAAGGCAATATGGGGAATGGG - Intergenic
909428674 1:75559536-75559558 GCAAAGGCAGTATCTGAACTGGG + Intronic
910097570 1:83540989-83541011 GCAAAGGCCAAATGTGGACATGG - Intergenic
912051251 1:105530551-105530573 AAAAAGGCAACATGTGGAATGGG - Intergenic
912729712 1:112091443-112091465 GCAAAAGCAATATTTGGGCTCGG - Intergenic
913069114 1:115283899-115283921 CCAAAGGCAAAATCTGCTCTAGG - Intergenic
915599389 1:156913056-156913078 CCAAAGGGAAGATGAGGAGTGGG + Intronic
916190434 1:162172460-162172482 GCAAAGCCATCATGTGGACTTGG - Intronic
916602228 1:166304342-166304364 CCAAAGTCAAGATGTTGACCAGG + Intergenic
916806988 1:168269059-168269081 CCAAAGGCCACATGTGAAATAGG - Intergenic
917541272 1:175916974-175916996 TCTAAGGCAAGAAGTGGACTTGG + Intergenic
917636402 1:176941295-176941317 TCAAAGGAAATATGTGACCTTGG + Intronic
918016291 1:180636212-180636234 CCAAAGGTATTATGTTGATTAGG + Intronic
918547260 1:185699238-185699260 GGAAAGGCAATCTATGGACTGGG - Intergenic
918920847 1:190707748-190707770 TCAAAGGTAATAGATGGACTTGG + Intergenic
921616023 1:217268731-217268753 CTAAAGGCAATTTATGGACTGGG + Intergenic
922248243 1:223821502-223821524 CCAAAGGTGAGGTGTGGACTGGG + Intronic
923890911 1:238214288-238214310 GCAAAGGCAAAATGTGGGGTTGG - Intergenic
924846713 1:247781953-247781975 GAAAAGGCAATCTGTGGAATAGG - Intergenic
924936634 1:248777497-248777519 GCAAAGGGAAAATGTGGAGTTGG + Intergenic
1062889207 10:1044928-1044950 TCACAGGCAATAGGTGAACTGGG + Intronic
1066302286 10:34107731-34107753 CCAAGGGCCACATGTGGCCTGGG - Intergenic
1070082018 10:73198406-73198428 GAAAAGGCAATATGTGGAATGGG + Intronic
1070205815 10:74260069-74260091 TCAAAGGTAATATGTGTACATGG + Intronic
1071196115 10:83162158-83162180 CCAAATGAAATATATGTACTGGG - Intergenic
1071606558 10:86997135-86997157 GCACAGACAATATGTGGATTTGG + Intergenic
1072018831 10:91378944-91378966 TCAAAGTCAAAATGTGGACAGGG - Intergenic
1072176725 10:92931146-92931168 GAAAAGGCAAGATATGGACTTGG + Intronic
1074699684 10:116082319-116082341 CCAAAGGCAATAAAAGGACTAGG - Intronic
1079304333 11:19309016-19309038 GCCAAGGCAATAGGTGGAGTGGG - Intergenic
1086609676 11:88740746-88740768 CCAAAGCCAGTATGTGCACAAGG + Intronic
1088688059 11:112301292-112301314 CCAAAGGCAATGTGTGGCCCTGG - Intergenic
1088734299 11:112714531-112714553 CCAAAAGCAAAATATGGGCTGGG + Intergenic
1092109199 12:5946820-5946842 CCAAAGGCACTATCTGTACCTGG - Intergenic
1092367320 12:7887721-7887743 CATAAGGCAATAGGTAGACTTGG - Intronic
1092670554 12:10856288-10856310 GCAAAGGGAAAATGTGGAGTTGG + Intronic
1092923318 12:13251681-13251703 CCAAAGGCAATCTGCTGGCTGGG - Intergenic
1092960559 12:13592992-13593014 CCCAAGGCAATCTGTAAACTGGG - Intronic
1092962379 12:13608626-13608648 CCAAGAGGAATATGTGGACCAGG - Exonic
1093436997 12:19147490-19147512 CTAAAGGCAGTATGTGGTATAGG + Intronic
1094067410 12:26376271-26376293 CCTAAGTGCATATGTGGACTTGG - Intronic
1094287878 12:28815283-28815305 CCAGAGGCCATATGTGGAGCTGG + Intergenic
1095666311 12:44803255-44803277 CCAAATGCAACATGTGTTCTTGG + Intronic
1097012916 12:55966032-55966054 CCAAAGGCACTGGGGGGACTGGG + Intronic
1097593418 12:61599430-61599452 CCAAAGGCAACATTTTGAGTTGG - Intergenic
1098424657 12:70347751-70347773 CAAAATACAGTATGTGGACTTGG - Intronic
1101228656 12:102715993-102716015 GCAAAGGCAATTTATGGAATGGG - Intergenic
1102314454 12:111875715-111875737 CTAAAGGCAAAATGTGGGCTAGG - Intronic
1102525628 12:113510536-113510558 CCAAAGTCAAAATGTGGGCAGGG + Intergenic
1103189001 12:118984370-118984392 CTAGAGGCAATCTGGGGACTTGG + Intronic
1107113663 13:36724208-36724230 CCAAAGGCAAAATGTGCATCTGG + Intergenic
1108199662 13:48030660-48030682 AAAAAGGCAAGCTGTGGACTGGG - Intergenic
1108358066 13:49644890-49644912 CCAAATGCAATGTGTGCACATGG - Intergenic
1110281245 13:73696618-73696640 CCAGAGGCCATATGTGGCCAAGG - Intronic
1115299039 14:31864061-31864083 TCAAAGGCAATTTATAGACTAGG + Intergenic
1115473739 14:33794755-33794777 CCAAAGGCAGAATGTAGACTGGG - Intronic
1117189618 14:53277434-53277456 CCAGAGGCCATATGTGGAGCTGG - Intergenic
1120141971 14:80939719-80939741 CCAGTGACAATATGTGGGCTGGG - Intronic
1124222643 15:27863447-27863469 CCAATGCCAATGTGTGGAGTGGG + Intronic
1124951823 15:34330149-34330171 CCAAATGCAGTGTGTGAACTTGG - Intronic
1125250192 15:37692719-37692741 TCAAAGGCATTATGTGGTGTGGG - Intergenic
1128896357 15:71377334-71377356 CCACAGGCAGTATGTGGGCTAGG + Intronic
1130287654 15:82569308-82569330 CCAAAGGCAACATGACGATTAGG + Intronic
1130346456 15:83051209-83051231 CCAAAGGTATTATGTTGGCTTGG + Intronic
1132109459 15:99091896-99091918 CCAAAAGCAAGAACTGGACTAGG + Intergenic
1134430157 16:14196527-14196549 TCAAAGGCAATATTTCCACTTGG + Intronic
1136032979 16:27516930-27516952 CCAAAGGAAAGATGTGCACCAGG - Intronic
1136048811 16:27636254-27636276 CCAAAGGCAGTAGCTGGACTTGG - Intronic
1137890260 16:52153478-52153500 CTAAATGCAATGTGTGAACTTGG - Intergenic
1139496509 16:67323638-67323660 CCACATGCAATGTGTGGACAAGG + Intronic
1139787762 16:69407726-69407748 CCAAAGGAAATATCTGGAGTAGG - Intronic
1139788781 16:69415175-69415197 CCAAAGGCAATTGGTGCATTTGG + Intergenic
1142954335 17:3511032-3511054 CCAAAGGCACTATCTGAACCTGG + Intronic
1145961779 17:28890812-28890834 TCAAAGGAAATATGTGATCTGGG + Intronic
1146281500 17:31548149-31548171 TGAAAGGCAATCTGTGGAATGGG - Intergenic
1147652051 17:42068294-42068316 CTTAAGGCAGCATGTGGACTAGG - Intergenic
1149188077 17:54025481-54025503 CCAAAGGCAATATGTTTATATGG + Intergenic
1152582299 17:81171484-81171506 AAAAAGGAAATATGTGGAGTGGG - Intergenic
1153198051 18:2622738-2622760 CTAAATGCAATGTGTGTACTGGG - Intergenic
1156196137 18:34776205-34776227 CCAAAGGCAGGATCTGGACAAGG + Intronic
1157590173 18:48831911-48831933 CCACAGGCCACATGTGGTCTTGG - Intronic
1158622025 18:59041108-59041130 CCAAACTCAATCTGGGGACTAGG + Intergenic
1158680138 18:59559652-59559674 CCAAAGACCACGTGTGGACTTGG + Intronic
1159529443 18:69636884-69636906 GCAAAGGCAAAATGCAGACTGGG + Intronic
1160341146 18:78089830-78089852 CCAAACTCGAGATGTGGACTAGG - Intergenic
1163052100 19:14692191-14692213 CCAAAGGCAATATGAGAACGTGG + Intronic
1166346216 19:42167789-42167811 CCATAGGCAATATGGGCAATGGG - Intronic
925769825 2:7270892-7270914 CCAAAGTCATTAAGTGCACTTGG - Intergenic
927039580 2:19214726-19214748 CCAATGGCAGTATCTGGAATAGG - Intergenic
927150573 2:20193078-20193100 GCAGAGGCACCATGTGGACTGGG + Intergenic
937204111 2:120224627-120224649 CCACAGGCAATCTGTGGCCCTGG + Intergenic
939338875 2:140867669-140867691 CCAAAGCCAATAAGTGGACAGGG - Exonic
939506654 2:143054856-143054878 ACAAATGCAATGTGTGGACTTGG + Exonic
939506886 2:143056892-143056914 GCAAAGGCGAAATGTGGAGTTGG - Intergenic
940572405 2:155455129-155455151 CTGAAGGCAATATGAAGACTGGG + Intergenic
941744801 2:169075620-169075642 CCAAATGCAATATGTGATCCTGG - Intronic
944258570 2:197651200-197651222 GAAAAGTCAATATGTGGAATGGG - Intronic
944392130 2:199228600-199228622 CCAGAGGCCACATGTGGAGTTGG - Intergenic
944874449 2:203947819-203947841 CAAAAAGGAATATGTGGTCTTGG - Intronic
944880376 2:204007147-204007169 CAAAAGGGAATAAGTTGACTAGG + Intergenic
945466867 2:210180344-210180366 CCATCAGGAATATGTGGACTGGG - Intergenic
945668627 2:212774123-212774145 CAAGAGGCAATATGCTGACTAGG + Intergenic
946283335 2:218682883-218682905 CTAAATGCAATGTGTGGGCTGGG - Intronic
947751051 2:232532513-232532535 CCAAAGGCCATCTGTAGAATGGG + Intronic
1169109112 20:3020524-3020546 CCAAAGGGAATTTGAGGCCTTGG + Intronic
1170464746 20:16612305-16612327 CCACAGGCAATATGTGACATTGG - Intergenic
1171120184 20:22561823-22561845 CCAAAGGCAACATTTTGGCTTGG + Intergenic
1171151780 20:22834073-22834095 CCTAAGGTAACCTGTGGACTGGG + Intergenic
1172928515 20:38563644-38563666 CAAAAGGAAAAATGTGCACTGGG - Intronic
1184708780 22:46234947-46234969 CCAAAGTCAATAGGTGAAGTAGG - Intronic
1185239017 22:49731510-49731532 GAAAAGGCAACATGTGGAATGGG - Intergenic
950934471 3:16824640-16824662 CCCAAGTCAATAGGTGAACTGGG - Intronic
953448294 3:42986186-42986208 TCAAAGGCATTATGCTGACTGGG + Intronic
953845311 3:46422046-46422068 CCAGAGGCCACATGTGGAATTGG - Intergenic
958585897 3:96087216-96087238 CCAAAGGAAATATGTAAACATGG + Intergenic
959773488 3:110127878-110127900 GCAAATGAACTATGTGGACTAGG - Intergenic
960409945 3:117310544-117310566 CCAAAGCCATTATGTGTAGTAGG - Intergenic
964081012 3:152756840-152756862 CCAAAGGGTATAAGTGTACTTGG - Intergenic
964542064 3:157790383-157790405 CCAAAGGCAATATTAAGTCTAGG + Intergenic
966442563 3:179962339-179962361 TCACAGGCAATATTTGAACTTGG - Intronic
971059939 4:22956506-22956528 CCACAGGCCATATTTGGCCTAGG + Intergenic
971062556 4:22989056-22989078 CCAAAGGCTATCAATGGACTGGG + Intergenic
972387039 4:38577257-38577279 CCAAAATCAATGTGTGGACTGGG - Intergenic
974402774 4:61426624-61426646 CCAGAGGCCATATGTGGAACTGG - Intronic
976342814 4:83964189-83964211 CCAGAGGCCACATGTGGACTTGG - Intergenic
978023008 4:103837175-103837197 CCAAATGCAGTCGGTGGACTTGG - Intergenic
979688225 4:123534739-123534761 GAAAAGGCAATCTATGGACTAGG + Intergenic
979797663 4:124867261-124867283 GCTAAGGCAATATTTGAACTTGG + Intergenic
980220986 4:129914889-129914911 CAAAAGGCAAAATGTGGATTAGG + Intergenic
984316582 4:178138310-178138332 CCGAAGGCCACATGTGGAATTGG + Intergenic
985701639 5:1377042-1377064 CCAAATGCAATGTGTGGTCCTGG - Intergenic
986889993 5:12290851-12290873 CCAAAAGCAATGTCTGGATTTGG - Intergenic
988781871 5:34529675-34529697 CCAAAGGCAAAATCCGGATTGGG - Intergenic
990168595 5:53021852-53021874 CCAAAAGCAAGAGGTGGACTTGG - Intronic
990746216 5:58961652-58961674 ACAAAGGCAATATCTACACTTGG - Intergenic
991301725 5:65134878-65134900 CCAAAGGCACTGTGTAGATTGGG - Intergenic
992793964 5:80238952-80238974 CCAAAGGCCAAGTGTGTACTGGG + Intronic
993624139 5:90203873-90203895 ACAAGGGCAATATGTGAATTAGG - Intergenic
994936075 5:106255325-106255347 GCAAAGGGAAAATGTGGAGTTGG + Intergenic
996344134 5:122471547-122471569 CCAAGGGCAAACTGTGGTCTGGG + Intergenic
997721003 5:136078463-136078485 CCACAGGCCATATGTGGCCCAGG - Intergenic
997747547 5:136312234-136312256 CCAAAGGCGTTATGAGGACATGG - Intronic
997752452 5:136359569-136359591 CCAAAGGCAGACTGTGGATTAGG + Intronic
998540721 5:142979005-142979027 TGAAATGCAATGTGTGGACTTGG + Intronic
999053871 5:148552723-148552745 CAAAAGTCAATCTGTGGAATTGG - Intronic
1000283647 5:159806252-159806274 AAAAAGGCAATCTGTGAACTGGG + Intergenic
1002028191 5:176409838-176409860 CCAAAGGAAATAATTGGACAAGG - Intronic
1004101801 6:12620142-12620164 CCAAAAGCAATATGTCAATTAGG - Intergenic
1004343855 6:14830587-14830609 CCAAAGACATGATGTGTACTGGG + Intergenic
1005598878 6:27406471-27406493 CCAAAGGCCATATATGGACTTGG - Intergenic
1005661291 6:28001690-28001712 CCAAAGGCCATCTGTGAACTTGG + Intergenic
1005696368 6:28356116-28356138 CCAAAGGCAATATGTGGACTCGG - Exonic
1010173181 6:72996531-72996553 CCACTGGCAATCTGTGTACTTGG - Intronic
1011055073 6:83195113-83195135 GCATAGGTAATACGTGGACTGGG + Intronic
1011205144 6:84885189-84885211 TCAAAGGCAAACTGTGAACTTGG + Intergenic
1011278430 6:85652353-85652375 CAAAATGCAATGTGTGAACTTGG - Intergenic
1012570960 6:100728067-100728089 ACAAATGCAATATGTGAGCTTGG + Intronic
1012782317 6:103578385-103578407 CGAAAGGAAATATGTAGACTTGG + Intergenic
1013624853 6:111926865-111926887 CCAAAGGTAATGTGAGGACTGGG - Intergenic
1014514273 6:122361921-122361943 CCAGAGGCCACATGTGGAATTGG + Intergenic
1014560058 6:122879109-122879131 CCTAAGGCAAAATATGGAATTGG + Intergenic
1015596817 6:134874282-134874304 CCAGAGGCCATATGCAGACTTGG - Intergenic
1016706366 6:147113304-147113326 CTAAAGGCAATAAGTGATCTTGG + Intergenic
1017679334 6:156847486-156847508 CCAGAGGCAAAATGAGGTCTGGG + Intronic
1019465459 7:1185694-1185716 CCACAGGCTGTATGTGGACAGGG + Intergenic
1020747028 7:12091208-12091230 CCAAAGACCATATGTGGACTTGG + Intergenic
1025794285 7:64723511-64723533 CAAAAGGCAAGAAGGGGACTTGG + Intergenic
1028335984 7:89655753-89655775 CTAAAGGGAATACTTGGACTAGG - Intergenic
1031515301 7:122692001-122692023 CCAAAGGCCATATGCGGACTTGG - Intronic
1032150530 7:129425586-129425608 CCAAAGGAGAGATGTGGAATAGG + Intronic
1033603755 7:142909679-142909701 CCAAAGGCAATCTGTGAGATAGG + Intronic
1033949760 7:146769871-146769893 ACAAAAGCAATCTGTGGGCTGGG + Intronic
1034198891 7:149268335-149268357 CCAAATGTAAAATGTGGACTTGG - Intronic
1034386264 7:150743679-150743701 TCAAAGGAAGCATGTGGACTGGG - Exonic
1038874733 8:31535786-31535808 CCAAGGGAAAGAAGTGGACTGGG + Intergenic
1039896833 8:41722806-41722828 CCACAGGCAATATGCAAACTAGG - Intronic
1041004408 8:53484861-53484883 CCAGAGGCTATATGTGGAGCTGG + Intergenic
1041529397 8:58846799-58846821 CCAAAAGCAAGATGTGTAATGGG + Intronic
1041906121 8:63035899-63035921 CCATAGGCTATGGGTGGACTTGG - Intronic
1041965660 8:63672344-63672366 CTCAATGCAATATGTGGACTTGG - Intergenic
1044179801 8:89177624-89177646 CCAAAAGCAATGTGAGGCCTGGG + Intergenic
1044810106 8:96051929-96051951 GAAAAGGCAATCTGTGGACCGGG + Intergenic
1048688837 8:136935601-136935623 CCAAAGGCACTATTTGACCTGGG - Intergenic
1051132921 9:13882847-13882869 CCCAAGACAGTATGTGGACAAGG + Intergenic
1051169341 9:14303418-14303440 ACAAAGGCAATATGGGGAATAGG + Intronic
1052009260 9:23386514-23386536 CCAAAGGGAATATGTCTATTGGG + Intergenic
1052963829 9:34323165-34323187 CTTAAGGCAAGATGTGGATTTGG + Intronic
1053635679 9:39998918-39998940 CCAAATGCATGATATGGACTAGG - Intergenic
1054208207 9:62251781-62251803 CCAAATGCATGATATGGACTAGG + Intergenic
1054548978 9:66377210-66377232 CCAAATGCATGATATGGACTAGG + Intergenic
1056888779 9:90469916-90469938 ATAAAGGCAAAATGTGGCCTGGG + Intergenic
1062599047 9:137311886-137311908 CCAAAGGCAAGACGTGCGCTGGG - Intronic
1186229252 X:7435530-7435552 CCAAAGTCAATATATGGAAATGG + Intergenic
1187145694 X:16635339-16635361 ACAAAAGAAATATGTTGACTAGG + Intronic
1188131465 X:26438924-26438946 CCTAAGGCCATATTTTGACTTGG + Intergenic
1188520023 X:31028693-31028715 CCAAATGCAGTATGTGATCTTGG + Intergenic
1189123201 X:38417247-38417269 CTAAAGGCAATATAGGGAATTGG + Intronic
1193814820 X:86091765-86091787 CCAAATGCAATATTTTAACTTGG + Intergenic
1194738973 X:97549705-97549727 CTAAATGCAACATGTGGGCTGGG - Intronic
1196476770 X:116096199-116096221 CAAAAGGCAATCTATGGAATGGG - Intergenic
1196799598 X:119530870-119530892 CCACAGACAAGATGAGGACTTGG - Intergenic