ID: 1005697059

View in Genome Browser
Species Human (GRCh38)
Location 6:28361386-28361408
Sequence ATTGGCTACTTTGTGACCCT GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 188
Summary {0: 1, 1: 0, 2: 1, 3: 14, 4: 172}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1005697059_1005697061 -8 Left 1005697059 6:28361386-28361408 CCCAGGGTCACAAAGTAGCCAAT 0: 1
1: 0
2: 1
3: 14
4: 172
Right 1005697061 6:28361401-28361423 TAGCCAATTTCAGCTAATGAAGG 0: 1
1: 0
2: 1
3: 9
4: 88
1005697059_1005697063 16 Left 1005697059 6:28361386-28361408 CCCAGGGTCACAAAGTAGCCAAT 0: 1
1: 0
2: 1
3: 14
4: 172
Right 1005697063 6:28361425-28361447 TCTGCTCAAGCATGAATCTGTGG 0: 1
1: 0
2: 2
3: 2
4: 141
1005697059_1005697064 17 Left 1005697059 6:28361386-28361408 CCCAGGGTCACAAAGTAGCCAAT 0: 1
1: 0
2: 1
3: 14
4: 172
Right 1005697064 6:28361426-28361448 CTGCTCAAGCATGAATCTGTGGG 0: 1
1: 0
2: 1
3: 5
4: 97

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1005697059 Original CRISPR ATTGGCTACTTTGTGACCCT GGG (reversed) Exonic