ID: 1005699518

View in Genome Browser
Species Human (GRCh38)
Location 6:28386415-28386437
Sequence TGAAATAACAATAACGGGGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 150
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 142}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1005699518_1005699524 6 Left 1005699518 6:28386415-28386437 CCCACCCCGTTATTGTTATTTCA 0: 1
1: 0
2: 0
3: 7
4: 142
Right 1005699524 6:28386444-28386466 ACATACATAAAATGCTTCAGAGG 0: 1
1: 0
2: 0
3: 30
4: 352
1005699518_1005699525 13 Left 1005699518 6:28386415-28386437 CCCACCCCGTTATTGTTATTTCA 0: 1
1: 0
2: 0
3: 7
4: 142
Right 1005699525 6:28386451-28386473 TAAAATGCTTCAGAGGTTTCTGG 0: 1
1: 0
2: 1
3: 19
4: 249
1005699518_1005699526 22 Left 1005699518 6:28386415-28386437 CCCACCCCGTTATTGTTATTTCA 0: 1
1: 0
2: 0
3: 7
4: 142
Right 1005699526 6:28386460-28386482 TCAGAGGTTTCTGGTTTCCTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1005699518 Original CRISPR TGAAATAACAATAACGGGGT GGG (reversed) Intronic
905961513 1:42046248-42046270 TAAAAAAACAATAAAGTGGTTGG + Intergenic
906308143 1:44734321-44734343 TGAAATAAGCATAATGGGCTAGG - Intergenic
906357457 1:45119273-45119295 TGGAATAAGAACAAGGGGGTTGG - Intronic
907365540 1:53956163-53956185 TGAAAATAAAATAACTGGGTAGG + Intronic
907812077 1:57880981-57881003 TGAAATAAGAAGAATGGAGTTGG + Intronic
908149676 1:61286941-61286963 TGGAAGAACACTAAGGGGGTTGG + Intronic
912677116 1:111693231-111693253 TGCCATAACCATAATGGGGTGGG + Intronic
915672696 1:157503807-157503829 TGAAATAGCAAGCTCGGGGTTGG - Intergenic
916576613 1:166072589-166072611 TGAAATAACCATACTGGAGTCGG + Intronic
917069758 1:171137518-171137540 TGAAGTAAAAAGAAAGGGGTAGG - Intergenic
921114930 1:212081117-212081139 TCAAATAACAATAAGGGCTTAGG + Intronic
1063704280 10:8415719-8415741 TGAAAAAAAAATGATGGGGTTGG + Intergenic
1066109721 10:32185173-32185195 TGAAATAAAAATAGCTGGGATGG + Intergenic
1066372629 10:34830108-34830130 TAAAATAATAATAATGGGGTAGG + Intergenic
1070146241 10:73775517-73775539 TGAAATATCAAAATGGGGGTTGG - Intronic
1073422761 10:103437781-103437803 AGAAATAACACTACCGGGCTGGG - Intronic
1077624343 11:3757191-3757213 TCAGATAAAAATAACGGGCTGGG + Intronic
1079432173 11:20402412-20402434 AGAAATAAAAATAACAGGCTGGG - Intronic
1080407144 11:31989309-31989331 TAAAATAATAATAAAGGGTTAGG + Intronic
1082013972 11:47470644-47470666 AGAGATAAGAATAAAGGGGTTGG - Exonic
1084026529 11:66453768-66453790 TGAAATAAAAATAAAGAGGCTGG - Intronic
1084325750 11:68399010-68399032 TGAAAAAACAAAAACAGGCTGGG - Intronic
1088671922 11:112149816-112149838 TGCAATCACAATAAAGGGATTGG + Intronic
1089231256 11:116978801-116978823 AGAAATAATAAATACGGGGTGGG - Intronic
1091150304 11:133322484-133322506 TGAATTAACAAGACTGGGGTGGG + Intronic
1092959882 12:13586037-13586059 TGAAATATCAATAACCATGTTGG + Intronic
1099597733 12:84689454-84689476 TAAAATAACATAACCGGGGTAGG - Intergenic
1102964530 12:117115604-117115626 TAAAATAAAAATAAAGGGCTGGG - Intergenic
1106235511 13:27857365-27857387 TTAAATAATAATAAGGGGGAAGG - Intergenic
1106497619 13:30295465-30295487 TGACAAAACATAAACGGGGTAGG + Intronic
1106837360 13:33649267-33649289 TGAAAAAACAATAACTGTGAAGG - Intergenic
1108960682 13:56224484-56224506 TTATATACCAATAACTGGGTAGG - Intergenic
1109327352 13:60884447-60884469 TAAAATAACAAATACTGGGTAGG + Intergenic
1110443499 13:75550390-75550412 TGAAATTACAAGGACTGGGTGGG - Intronic
1110659674 13:78045390-78045412 TGAAATAACAATTACAGTTTGGG + Intergenic
1111838364 13:93417560-93417582 TGAAATAACCAAAATGAGGTGGG + Intronic
1111923217 13:94434486-94434508 TTAAATAATAATATCAGGGTGGG + Intergenic
1113049586 13:106195376-106195398 GGAAATGACAATAGCGGGGTGGG + Intergenic
1113595840 13:111531144-111531166 TTAAATAACAATAAGGAGATTGG + Intergenic
1118236872 14:64013746-64013768 TGAAAAATCAATAACTGGGGAGG - Intronic
1118523324 14:66612321-66612343 TAAAAGAACAATAACTGGATAGG - Intronic
1202927694 14_KI270725v1_random:5968-5990 TGAAATAACAAAAATGCGGGGGG - Intergenic
1124009511 15:25826261-25826283 TGAAAAAATAATGACTGGGTTGG + Intronic
1125112397 15:36048342-36048364 TGAAATAATAATTACGCTGTTGG + Intergenic
1127357494 15:58214566-58214588 TGAAAACACAAAAAGGGGGTGGG + Intronic
1127944133 15:63732879-63732901 TAAAAAAAGAATAAAGGGGTAGG - Intronic
1129863393 15:78881980-78882002 AGAAATAAAATTAACTGGGTTGG - Intronic
1133475789 16:6120573-6120595 TCATATAACAAACACGGGGTAGG - Intronic
1133548366 16:6829895-6829917 TAAAATAAAAATAAAGGGCTGGG - Intronic
1138118895 16:54382343-54382365 TGAAGAAACACTAAGGGGGTGGG - Intergenic
1139159133 16:64481902-64481924 TGAAATAAGATTGAGGGGGTGGG - Intergenic
1139450608 16:67025811-67025833 TGAAATAACAAAATGGGGGCTGG - Intergenic
1142882570 17:2893335-2893357 TAAAATAACAGTAAGGGGGCTGG - Intronic
1143394604 17:6582524-6582546 CGAAAAAACAAAAACTGGGTGGG - Intronic
1149945102 17:60916523-60916545 TGAAAGAACAACAATGGGGTGGG + Intronic
1153302446 18:3603078-3603100 TGAATTACCAATAAAGGGTTGGG + Intronic
1154006122 18:10528578-10528600 TCAAATAACAGTACAGGGGTAGG + Intronic
1155269046 18:24121843-24121865 TGATCTAAAAATAATGGGGTTGG + Intronic
1157425520 18:47581015-47581037 AGAAATAAAAAGAAGGGGGTGGG + Intergenic
1158612332 18:58952704-58952726 TGGAATAAAAACAGCGGGGTGGG - Intronic
1158989456 18:62853663-62853685 TGTATTAACAATAACAGGCTGGG - Intronic
1160593500 18:79958391-79958413 TCAATTAAGAATAACGAGGTTGG - Intergenic
1161325695 19:3662859-3662881 TCAAAAAATAATAACGGGGCCGG - Intronic
1165401920 19:35606515-35606537 TGAAATAAAAATAACAAGGAGGG - Intergenic
925965056 2:9057312-9057334 TGAAATAACAATAACCATGGAGG - Intergenic
927659468 2:24980729-24980751 TTAAAAAACAATAACAGGGCTGG + Intergenic
933645876 2:84812317-84812339 TGAAAGAACAAAAAAGGGGTTGG - Intronic
935335174 2:102009362-102009384 TGAAAGTATAATAACGGGGTAGG + Intronic
937954095 2:127409675-127409697 AAAAATAACAATGACGGGCTGGG + Intergenic
938170082 2:129068354-129068376 TGAAATAAAAATAAAGAAGTTGG - Intergenic
938987024 2:136586561-136586583 TAAAATAACATTAACGTTGTAGG + Intergenic
942191389 2:173473892-173473914 CAAAAGAACAATAACGGGGATGG - Intergenic
946063276 2:216963986-216964008 TGAAATAACAATAAAGGATTTGG + Intergenic
946306090 2:218857851-218857873 TGCAATAACAGTAGCAGGGTGGG + Intergenic
947165784 2:227260415-227260437 TGAAATCAGAATCACAGGGTGGG - Intronic
1170115313 20:12851659-12851681 TGAAATAACAATCAACGGGGAGG - Intergenic
1172727385 20:37056048-37056070 AGAAATAAGAATAACGGGAGAGG + Intronic
1172828865 20:37814733-37814755 TGAAAGAAAAAAAACGGAGTAGG + Intronic
1173280288 20:41620845-41620867 TGAAATAACATAAATGAGGTGGG + Intergenic
1174009218 20:47436137-47436159 AGAAATAAAAATAAAGGGGAAGG - Intergenic
1176589715 21:8634628-8634650 TGAAATAACAAAAATGCGGGGGG - Intergenic
1179670078 21:42940773-42940795 TCAAAAAACAAAAACAGGGTCGG - Intergenic
1180272548 22:10611643-10611665 TGAAATAACAAAAATGCGGGGGG - Intergenic
1183593071 22:38792854-38792876 TAAAATAACAATAAAAGTGTAGG + Intronic
952251522 3:31660594-31660616 TGAAACAACACTCACTGGGTAGG + Exonic
952931812 3:38366263-38366285 TGAAATAACAATATGTGGGTGGG + Intronic
955928676 3:64033533-64033555 ATAAATAAAAATAACGGGTTAGG - Intergenic
956654210 3:71533601-71533623 TCACAGAACAATAATGGGGTTGG - Intronic
957722594 3:84023313-84023335 TGATATAAGAATAGCGAGGTTGG - Intergenic
958121530 3:89295884-89295906 TGAAATGACAACAAAGAGGTCGG - Intronic
958800907 3:98754503-98754525 TGAAATGACAACAAAGGGTTAGG + Intronic
958907135 3:99954527-99954549 TAAAATAAGAATAACTGGGCTGG + Intronic
961775497 3:129281393-129281415 TGAAATAAAGATAACAGGCTGGG + Intronic
961942352 3:130650995-130651017 TGAAATAAGCATAACAGAGTTGG + Intronic
962593018 3:136910340-136910362 TAAAATAACCAAAAGGGGGTAGG - Intronic
963653936 3:148021592-148021614 TGAAATAACAGTAGCTGGCTGGG - Intergenic
964183219 3:153912894-153912916 AGAAATAACAATGAAGGGGAGGG + Intergenic
968496457 4:920014-920036 TTAAAAAACAAAAACAGGGTGGG + Intronic
971315628 4:25565437-25565459 TGAAATAACAATACGTGGATTGG + Intergenic
975283733 4:72593385-72593407 TGAAATAAGAATAAAAGAGTTGG + Intergenic
975626317 4:76352107-76352129 TAAAATAACCATAACTGGCTGGG + Intronic
977107079 4:92900420-92900442 TGAAATAGCAAACACTGGGTGGG - Intronic
977394940 4:96458866-96458888 TGAAATAACAAGCAAGAGGTTGG + Intergenic
978216606 4:106213340-106213362 AGAAATAAGAATACCGGGGGAGG + Intronic
979425955 4:120566630-120566652 TGAAATAATAATAAAAGAGTAGG - Intergenic
984130433 4:175868323-175868345 TAAAATAACAATAAAGGACTGGG - Intronic
989418082 5:41204063-41204085 TAAACTGGCAATAACGGGGTGGG - Intronic
990096882 5:52126581-52126603 TAAAATAATAATAAAGGGGCTGG + Intergenic
993109289 5:83635911-83635933 AGAAGTAACAATAATAGGGTAGG + Intergenic
993222686 5:85121774-85121796 TGAACCAAAATTAACGGGGTAGG - Intergenic
999835026 5:155360552-155360574 TGAAATGACAACAAAGGGCTTGG - Intergenic
999856782 5:155603563-155603585 TGAAATGACAACAAAGGGTTTGG - Intergenic
1001604715 5:172951439-172951461 TGGAAGAACAAGAAAGGGGTGGG - Exonic
1004088644 6:12476484-12476506 TGAAAGAGAAATAAAGGGGTAGG + Intergenic
1005699518 6:28386415-28386437 TGAAATAACAATAACGGGGTGGG - Intronic
1010232908 6:73551244-73551266 TTAAATAAAAATAACAGGCTGGG + Intergenic
1011448519 6:87468872-87468894 TAAAATAACAATAACTTGGGAGG + Intronic
1013058599 6:106609741-106609763 TGAACTGACAATAATGAGGTCGG - Intronic
1015742665 6:136473958-136473980 TGAAAAAACAATATTGGGGGTGG + Intronic
1017382035 6:153842533-153842555 TGTAATATCAGTAACGGGGATGG + Intergenic
1020194760 7:6028545-6028567 TTAAATAACAATACAGGGTTGGG - Intronic
1020256867 7:6507378-6507400 TGAAAAAAAAAAAAAGGGGTGGG + Intronic
1021489144 7:21199510-21199532 AGCAATAAAAATAACGGTGTTGG + Intergenic
1029107932 7:98193671-98193693 TGAGATGACAATGACCGGGTTGG - Exonic
1029527980 7:101107098-101107120 TGAAAAAACAAAAACGGGCCGGG - Intergenic
1032999481 7:137487836-137487858 TGAAATAATAAAAAAGGTGTAGG - Intronic
1034789526 7:153955732-153955754 TAAAATAACAACAACGGGCCGGG - Intronic
1035687555 8:1536779-1536801 GGAAATAAAAATAAAGAGGTGGG - Intronic
1039346648 8:36712374-36712396 TGAAATCACAGTAAGGGGCTGGG + Intergenic
1040836279 8:51734882-51734904 TGAAATAAACATAATAGGGTTGG + Intronic
1042969473 8:74392112-74392134 TTAAATAAAAATAACTGGCTGGG - Intronic
1046565836 8:115899934-115899956 TGCTATAAAAATAAGGGGGTGGG - Intergenic
1047488234 8:125352183-125352205 TGAAATAACAATTTGGGGCTGGG + Intronic
1050384747 9:5076187-5076209 TGAAATGACAACAAAGGGTTTGG + Intronic
1050830977 9:10012279-10012301 AGAGATAACAAAAAGGGGGTAGG + Intronic
1050836710 9:10090138-10090160 TGAAATAACAGTTACTGGGATGG - Intronic
1052273032 9:26647197-26647219 TGAAATAAGAATAAATGTGTTGG + Intergenic
1054777354 9:69134741-69134763 TGAAGTACCAATGACTGGGTGGG + Intronic
1056079577 9:83077826-83077848 TGAATTAACATTAACCAGGTAGG + Intergenic
1203619732 Un_KI270749v1:113277-113299 TGAAATAACAAAAATGCGGGGGG - Intergenic
1185569006 X:1118272-1118294 AGAAATAACAGTAATGGGCTGGG + Intergenic
1187204142 X:17166137-17166159 GATAATAACAATAGCGGGGTTGG + Intergenic
1187227203 X:17384997-17385019 GGAAATAAAAATAATGAGGTAGG + Intronic
1189998706 X:46664033-46664055 TAAAATAATAATGACGGGGGTGG + Intronic
1194047834 X:89031341-89031363 TGAAATAACACAAACGTGGCTGG - Intergenic
1194114507 X:89879710-89879732 TTACATAACAATAAAGGGGCCGG + Intergenic
1194916017 X:99709683-99709705 TGAAAAAACATTAAAGGAGTTGG - Intergenic
1198424611 X:136504171-136504193 TGAAATAAAAATAATGGGCAGGG - Intronic
1200416318 Y:2915301-2915323 TGAAAAAGAAATAAAGGGGTTGG + Intronic
1200467248 Y:3535076-3535098 TTACATAACAATAAAGGGGCCGG + Intergenic