ID: 1005699844

View in Genome Browser
Species Human (GRCh38)
Location 6:28389399-28389421
Sequence CACTGCAGACTTTTAGCACA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 191
Summary {0: 1, 1: 0, 2: 2, 3: 15, 4: 173}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1005699844_1005699848 5 Left 1005699844 6:28389399-28389421 CCTTGTGCTAAAAGTCTGCAGTG 0: 1
1: 0
2: 2
3: 15
4: 173
Right 1005699848 6:28389427-28389449 TAGTTTATAGGACTGTGTTCAGG No data
1005699844_1005699846 -7 Left 1005699844 6:28389399-28389421 CCTTGTGCTAAAAGTCTGCAGTG 0: 1
1: 0
2: 2
3: 15
4: 173
Right 1005699846 6:28389415-28389437 TGCAGTGGCCTTTAGTTTATAGG 0: 1
1: 0
2: 1
3: 11
4: 102

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1005699844 Original CRISPR CACTGCAGACTTTTAGCACA AGG (reversed) Intronic
903364648 1:22798526-22798548 CACTGCAGAGATTCAGAACATGG - Intronic
904663249 1:32100685-32100707 CAGTGCACACATGTAGCACAAGG + Intronic
904721041 1:32508782-32508804 CACAGCACAATATTAGCACAGGG - Intronic
905826779 1:41031652-41031674 CACAGTAGACTTTTAAGACAGGG - Intronic
905835928 1:41120948-41120970 CACTGCAAATGCTTAGCACAAGG - Intronic
905940650 1:41860633-41860655 CACTGCAAAATTTTTGCAAAAGG - Intronic
908608468 1:65827011-65827033 TACTGCATACATTAAGCACAGGG + Intronic
909961738 1:81854600-81854622 CACTGCATAGTCTGAGCACATGG - Intronic
912254093 1:108041394-108041416 AACTCCAGGCTTTTGGCACAGGG + Intergenic
912486382 1:110032369-110032391 CACTGGAGAGTTGTATCACAGGG + Intronic
913349613 1:117842866-117842888 CTCTGCACAGTATTAGCACAAGG - Intergenic
914225238 1:145714559-145714581 CACTGCTGGCCTTTAGCCCAGGG - Intergenic
914774494 1:150723770-150723792 CACTGGATATTTTAAGCACATGG - Intergenic
915570183 1:156741068-156741090 CACTTCGGATTTTCAGCACATGG + Exonic
915683555 1:157606597-157606619 CAGGGCAGACTTTTGGCCCAAGG + Intergenic
920193779 1:204212780-204212802 CACTGGAGACTTATAGACCATGG - Intronic
923855321 1:237839298-237839320 CTCTGCACAGTGTTAGCACAAGG - Intergenic
1062782236 10:224096-224118 CACTGCAAACTCTTAGAAAAGGG - Intronic
1064507642 10:16050562-16050584 CACTGCAAACTTTTAACTCCAGG + Intergenic
1064863974 10:19858448-19858470 CACTGCAATCTTTAAGCAAAAGG - Intronic
1068078107 10:52283392-52283414 GACTGAGGACTTTGAGCACAGGG + Intronic
1068462931 10:57350983-57351005 CTCTGCACAGTGTTAGCACAAGG + Intergenic
1069277946 10:66616247-66616269 CACTGCAGACATTTAACACAAGG - Intronic
1070304264 10:75229259-75229281 CACAGCAGCCTTAAAGCACAGGG - Intronic
1070549192 10:77477206-77477228 CACTGCAGACATTTCTCAGAGGG - Intronic
1070576046 10:77679924-77679946 CACAGCAGACATTCAGCACATGG - Intergenic
1072444442 10:95486341-95486363 CACTGCTGCCCTTTAGAACAAGG - Intronic
1073388126 10:103145205-103145227 CACTGCATACTTTAAGCATTTGG - Intronic
1073711570 10:106048856-106048878 CTCTGCAGGATTTCAGCACAGGG + Intergenic
1078578053 11:12517812-12517834 CACTGAAGACGTTGAGCAGAGGG - Intronic
1079927441 11:26512211-26512233 CTCTGCAAATTGTTAGCACAGGG - Intronic
1080646507 11:34191987-34192009 CACTACATACTTTTAGAACAGGG - Intronic
1081335742 11:41864010-41864032 CTCTGCAGATTCCTAGCACAAGG + Intergenic
1087619912 11:100529106-100529128 CTCTGCACAGTTTTAGCGCAAGG - Intergenic
1088913957 11:114212868-114212890 CTCTGCAGATTTTTAGAAAAGGG - Intronic
1093709791 12:22317557-22317579 AACTGCAGTTTTTTCGCACAAGG + Intronic
1097148032 12:56954985-56955007 CACTGGAGACGTTGACCACACGG + Exonic
1097718630 12:62996281-62996303 CACTTCAGAGTATTAGTACATGG + Intergenic
1098169075 12:67727971-67727993 CACTGCAGACTGTCTGCACTTGG - Intergenic
1100384506 12:94092994-94093016 AACTGCAGAGGTTTAACACACGG + Intergenic
1100777689 12:97990500-97990522 CACAGAAGAGATTTAGCACAAGG + Intergenic
1100846044 12:98659226-98659248 AACTGCAGAATCTTTGCACACGG + Exonic
1101462869 12:104914536-104914558 CACTGTAGACTACTAGCTCAAGG - Intronic
1101774554 12:107781828-107781850 CATTGCAGGCTTATAGCACTTGG - Intergenic
1106316839 13:28601818-28601840 CACTGCAAACTTCTAGAATAAGG - Intergenic
1110186159 13:72677376-72677398 CACTGCAGACTTTTGAATCATGG - Intergenic
1110287983 13:73772389-73772411 CACTGCAGCTGTTTATCACATGG - Intronic
1111108615 13:83677240-83677262 CTCACCAGACTTTTACCACATGG + Intergenic
1112393394 13:99005685-99005707 CACAGCAAACTTTTTGCAAAGGG + Intronic
1113552470 13:111203989-111204011 CACTGCAGATTTTTAGTCTAGGG + Intronic
1115016588 14:28622966-28622988 CACTTCAGACTGTTAGCATTTGG - Intergenic
1119033728 14:71212629-71212651 CTCTCCATACTTTTGGCACAGGG - Intergenic
1120683872 14:87514417-87514439 GATTGGAGACTTTGAGCACATGG - Intergenic
1120738627 14:88083162-88083184 CACTGGAGACCTTTAGTGCAGGG - Intergenic
1121257802 14:92544044-92544066 CACAGCTGACTTTTAGCAAATGG - Intronic
1122100162 14:99402137-99402159 GACTGAAGACCTTTAGCATAGGG - Intronic
1122172289 14:99886929-99886951 CACTGTGGACTTTGGGCACAGGG - Intronic
1126171119 15:45696192-45696214 CATTTCAGACTTTCAGCACTGGG + Intergenic
1127875748 15:63109957-63109979 CACTGTAGCCTTTTATCAGACGG - Intergenic
1129094609 15:73191137-73191159 TATGTCAGACTTTTAGCACAAGG - Intronic
1129793986 15:78362165-78362187 CACAGCAGGCTCTTAGCACTCGG + Intergenic
1133743644 16:8670816-8670838 CACGGCAGATTTTTCGCAAAGGG + Intergenic
1133782478 16:8950533-8950555 CACTGAAGACTTTGATCACTTGG + Intronic
1135837369 16:25838765-25838787 CACTGCAGACTTTCAAAATAAGG + Intronic
1138695621 16:58810413-58810435 TACTGCATACTTTTATCATAGGG + Intergenic
1141590677 16:85066658-85066680 CATTTCAGACTGTCAGCACACGG - Intronic
1142496286 17:307733-307755 CACTGCTGACCTTCAGCTCAGGG - Intronic
1142575643 17:905340-905362 CACTGCAGCCTCTTAGCTCCTGG - Intronic
1144939053 17:18924415-18924437 CAAAGCAAACATTTAGCACAAGG - Intronic
1144948751 17:18982914-18982936 CACAGCAGCCTTGCAGCACAAGG - Intronic
1144968758 17:19093980-19094002 CCCTGCACACCTTGAGCACATGG + Exonic
1145201351 17:20948069-20948091 CACTGGGGCCTCTTAGCACAGGG + Intergenic
1150436157 17:65155883-65155905 GACTGCCCACTTTTTGCACATGG + Intronic
1156536039 18:37865537-37865559 CACTGCAGAATATTAGCCCACGG + Intergenic
1163156725 19:15443742-15443764 CACTGCAGCATTCTAGCACCTGG + Intronic
1163371669 19:16904380-16904402 CACTGGGGACTTTTGACACAGGG + Intronic
1166049806 19:40251987-40252009 CACTGCAGACGTGTTTCACATGG - Intronic
926776539 2:16429099-16429121 CATTGCAGATTGATAGCACATGG + Intergenic
927233642 2:20849854-20849876 CACTGCATAATATGAGCACATGG + Intergenic
927322968 2:21769991-21770013 CACACCAGCCTTTGAGCACAGGG + Intergenic
927617096 2:24609541-24609563 CACTGCAGCCTTTTAACTCCTGG - Intronic
930412680 2:51046720-51046742 GATTGCATACTTTTATCACATGG + Intergenic
931617537 2:64175515-64175537 GACTGCAGAGTTCTAGCACTCGG - Intergenic
932105651 2:68938947-68938969 CACTGCAGACTATTAGAGGAAGG - Intergenic
933829583 2:86195946-86195968 CACTTGACACGTTTAGCACAAGG - Intergenic
933862809 2:86486992-86487014 CACTGCAGACCCACAGCACATGG - Intronic
936573459 2:113635043-113635065 CATTGCAGACTTTTGGGACACGG + Exonic
936627106 2:114160240-114160262 CCCTACAGAATTTTATCACATGG + Intergenic
937914734 2:127093223-127093245 CACTGCAGACTCTGAACAAAGGG + Intronic
939541294 2:143497307-143497329 CGCAGCAGACTTCTAACACAAGG - Intronic
941584870 2:167345386-167345408 AACTGAAGTCTTTAAGCACAGGG + Intergenic
942041353 2:172066895-172066917 CTCTGCTTACTTTGAGCACAAGG - Intronic
943658518 2:190534191-190534213 GTCTCCAGACTTTCAGCACACGG - Intronic
943666655 2:190616054-190616076 AACTGCAGACTTTTAACAGAAGG - Intergenic
946297708 2:218798990-218799012 GACTTCAGTCTTTTTGCACAAGG - Intronic
947932706 2:233976720-233976742 CACTGCTGACCCTAAGCACAGGG - Intronic
948187337 2:236031794-236031816 CACTGGGGACTCTGAGCACAGGG - Intronic
1171394486 20:24823097-24823119 CACTGCAGAATTTTAAAAAACGG - Intergenic
1175782702 20:61693588-61693610 CACTGCAGCCTTTTAGAGCGTGG + Intronic
1184828083 22:46966725-46966747 GCCTGCAGACTTTTTCCACATGG + Intronic
1185115006 22:48928887-48928909 CACAGCATACTATCAGCACAAGG - Intergenic
1185232921 22:49693689-49693711 CCCTGCAGCCTTGTTGCACACGG - Intergenic
1185426723 22:50775837-50775859 CATTGCAGACTTTTGGGACACGG - Exonic
950923060 3:16715131-16715153 CTCTGCACAGTGTTAGCACAAGG + Intergenic
952144627 3:30518320-30518342 CACTGCAGTTTTCTTGCACAAGG + Intergenic
957633570 3:82751028-82751050 CACTGTAGACTTTTTAAACATGG + Intergenic
958516030 3:95117056-95117078 AAATGCAGACTTTTAGCCCCAGG - Intergenic
962848668 3:139291351-139291373 CTCTGCAGGATTTTACCACATGG - Intronic
963913975 3:150841062-150841084 CTCTGCACAGTGTTAGCACAAGG + Intergenic
964051885 3:152403847-152403869 CAGTGCACAATTTTAGCAAATGG + Intronic
966055532 3:175684122-175684144 GCCAGCAGACTTTTAGAACATGG + Intronic
967479163 3:189954634-189954656 AGCTGCAGACTTTTCACACAAGG + Intergenic
967603777 3:191419882-191419904 CATTGCAAACTTTTTGCAGATGG - Intergenic
968682057 4:1927971-1927993 CACTGCAGCCTTGGAGCTCAGGG - Intronic
969831674 4:9802635-9802657 CACTGCAAACCTTTACCTCAAGG + Intronic
973658787 4:53080457-53080479 CACTTCAAACTTTTAGCATAAGG - Intronic
974215255 4:58838203-58838225 CACTGGGGACTTTTAGAGCAGGG + Intergenic
975363630 4:73502384-73502406 AACTGCAGGATGTTAGCACAAGG - Intronic
975592432 4:76013391-76013413 CACTGCAGAATTTTAACTAAGGG + Intronic
975958482 4:79871750-79871772 CACAGCAGATTTTTAGGGCAAGG + Intergenic
976277746 4:83294682-83294704 CACTGCAGCCTTTTAACTCCTGG - Exonic
976956471 4:90907117-90907139 AATTGCAGACCTTTACCACAGGG + Intronic
978528507 4:109691057-109691079 CACTGCACACATTAAGCACTGGG - Intronic
979471776 4:121107452-121107474 CACTGCAGACCTCTTCCACAAGG + Intergenic
979599140 4:122567826-122567848 CACTGCTGAATTTTACCAAATGG - Intergenic
980034761 4:127871146-127871168 CACTGCAGAGATTGAGCAGAGGG + Intergenic
984502280 4:180571374-180571396 CACTGCACACTTTTAGGCCCTGG + Intergenic
986038748 5:3965570-3965592 CACTGCAGACTCTCAGCGCATGG + Intergenic
987119226 5:14750917-14750939 CCCTGCAGACATCTAGCACTTGG + Intronic
989987686 5:50720962-50720984 CCCTGGAGACTTGGAGCACAAGG - Intronic
992870647 5:81002032-81002054 CACTGTAGTTTTTTAGCAAATGG + Intronic
994247074 5:97489700-97489722 CACTGTTGACTTTTAACACTAGG + Intergenic
996633165 5:125661622-125661644 CCCTGCAGACTATGAGAACAGGG - Intergenic
998562525 5:143184642-143184664 CACTGCAGTGTTTCAGAACAAGG - Intronic
998994475 5:147855434-147855456 CACTTCTGACTTTCTGCACATGG - Intergenic
1003051742 6:2786809-2786831 CAGTGCAGACTTTTAAAACACGG - Intronic
1003624883 6:7731712-7731734 CAGTGAAGACATTTAGGACAGGG + Intronic
1004806086 6:19205294-19205316 CTCTGCACAGTGTTAGCACAAGG + Intergenic
1005699844 6:28389399-28389421 CACTGCAGACTTTTAGCACAAGG - Intronic
1006253119 6:32807452-32807474 CTCTGCACAGTGTTAGCACAGGG + Intergenic
1010166748 6:72923702-72923724 CACTGCAGACTACTAGGGCAGGG - Intronic
1011763026 6:90588600-90588622 ACCTGCAGAGTTATAGCACAAGG - Intergenic
1011860654 6:91751809-91751831 CACTGCACACTTTTGGAAAAGGG - Intergenic
1014041475 6:116832029-116832051 CACTGCAGCCTTTCATCACTGGG - Intergenic
1015325552 6:131919157-131919179 CTCTGCACAGTGTTAGCACAAGG - Intergenic
1017684920 6:156903143-156903165 CACTGATGACTTCCAGCACATGG + Intronic
1017964102 6:159248707-159248729 CACTGTAGCCTTGTAGCTCATGG - Intronic
1022540415 7:31129505-31129527 CACGGCAGACATTTAGCACACGG + Intergenic
1024445464 7:49473284-49473306 CACTGCAGAATATTAGCCCCGGG - Intergenic
1025785590 7:64640629-64640651 CAATGCAGATATTTATCACAAGG - Intergenic
1026159497 7:67856250-67856272 CACTGCAGCCCTTTAGCCCTGGG + Intergenic
1027711734 7:81612138-81612160 CACTGGAGATTTTTTGCTCATGG - Intergenic
1029191873 7:98777746-98777768 CACTGCAGCCTTTTAACTCCTGG + Intergenic
1029798184 7:102917494-102917516 CACTGCAGACTTCTGGTAGATGG + Intronic
1030273397 7:107693909-107693931 CACTTCGTACTTGTAGCACATGG - Intronic
1030656791 7:112177221-112177243 GACAGCAGACTTTGAGCCCAGGG - Intronic
1030923924 7:115427574-115427596 CATGGCATACTTTTAGCACAAGG + Intergenic
1032506387 7:132437789-132437811 CACTGCAGACTGTCAGCAGCAGG + Intronic
1034009819 7:147517391-147517413 CACCCCATCCTTTTAGCACATGG - Intronic
1036587469 8:10137684-10137706 CACTGCCCACTTTGTGCACAAGG - Intronic
1039264460 8:35809240-35809262 CTCTGCACAGTGTTAGCACAAGG - Intergenic
1039725026 8:40206315-40206337 CACTGCTGACTCTGAGCACATGG - Intergenic
1040050777 8:43011801-43011823 CACTGCAGCCTTGAACCACAGGG - Intronic
1040816095 8:51510075-51510097 CTCTACAGACCCTTAGCACAAGG + Intronic
1043308622 8:78829542-78829564 CACAGCAGATTTTTAGTTCAAGG - Intergenic
1043884349 8:85581327-85581349 CACTGCAGACTCATAGTAGAAGG - Intergenic
1043916494 8:85928706-85928728 CACTGAAGACATTAAGCAAAAGG + Intergenic
1045329112 8:101140308-101140330 CACTGGAGGCCTTTAGCACAAGG - Intergenic
1047834590 8:128674650-128674672 CACTGCAGACTATTAGCGAGGGG - Intergenic
1050496660 9:6249867-6249889 CACTGTAGACACTTAGCAAATGG + Intronic
1052000796 9:23277824-23277846 CATTGCAGAGTTTTAGAATAAGG + Intergenic
1052951447 9:34216564-34216586 CACTGCAGCCTTTTACCACCTGG + Intronic
1053267657 9:36726687-36726709 CACTCCAGACTTTCAGCAGGAGG - Intergenic
1056093716 9:83229870-83229892 CACTGAATATTTTAAGCACACGG - Intergenic
1057862643 9:98653809-98653831 CAGTGCTGACCTTTAGCTCATGG + Intronic
1059641940 9:116226071-116226093 CTCTGCAGACTTTTTTCACTTGG - Intronic
1060559927 9:124534458-124534480 CTCTGCAGACCTGGAGCACAGGG - Intronic
1061769168 9:132904546-132904568 CATTGCAGATTTTGACCACAAGG - Intronic
1187804254 X:23100804-23100826 CACTGCTGATTTTTGGCTCAGGG + Intergenic
1188232461 X:27682037-27682059 CACTGCAGCCTTGTAGCCCTGGG + Intronic
1190539072 X:51458642-51458664 CACTTCAGTCTTTTACAACAGGG + Intergenic
1191137680 X:57083157-57083179 CTCTGCACAATGTTAGCACAGGG - Intergenic
1193430418 X:81395921-81395943 CACTGTAGACTATTAGAGCAGGG + Intergenic
1194000762 X:88425928-88425950 CACTGCAAACTGTCAGCAGATGG + Intergenic
1195438707 X:104876259-104876281 CTCTGAAGGCATTTAGCACATGG + Intronic
1195567819 X:106363261-106363283 CTCTGCACAGTGTTAGCACAAGG + Intergenic
1197562563 X:128041810-128041832 CACTGCAGACTCTTAGAGCAGGG - Intergenic
1198261093 X:134965449-134965471 CACTGCAGGCTTTTGTCCCAAGG - Intergenic
1200176578 X:154121370-154121392 CATGGCAGACTTTTAGCCCTTGG + Intergenic
1200356546 X:155557993-155558015 CCCTTCAAACTTTTTGCACATGG + Intronic
1200852749 Y:7902544-7902566 AACTGCAGACTTTTTGCAAGTGG - Intergenic