ID: 1005701242

View in Genome Browser
Species Human (GRCh38)
Location 6:28402478-28402500
Sequence TAGTGTCAAAAGACGGAGAT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1005701242_1005701245 18 Left 1005701242 6:28402478-28402500 CCAATCTCCGTCTTTTGACACTA No data
Right 1005701245 6:28402519-28402541 GAGACAAAGAGCAGACAAAATGG No data
1005701242_1005701244 -10 Left 1005701242 6:28402478-28402500 CCAATCTCCGTCTTTTGACACTA No data
Right 1005701244 6:28402491-28402513 TTTGACACTAGAGAAACACAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1005701242 Original CRISPR TAGTGTCAAAAGACGGAGAT TGG (reversed) Intergenic
No off target data available for this crispr