ID: 1005710592

View in Genome Browser
Species Human (GRCh38)
Location 6:28500464-28500486
Sequence TTCTTAACACCACTGGTAGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1005710590_1005710592 18 Left 1005710590 6:28500423-28500445 CCACTTCAGAGATTTAAAAGAAG No data
Right 1005710592 6:28500464-28500486 TTCTTAACACCACTGGTAGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1005710592 Original CRISPR TTCTTAACACCACTGGTAGC TGG Intergenic
No off target data available for this crispr