ID: 1005710984

View in Genome Browser
Species Human (GRCh38)
Location 6:28502583-28502605
Sequence CGGCGTGGCGGCCGAGCAGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1005710984_1005710992 12 Left 1005710984 6:28502583-28502605 CCCTCTGCTCGGCCGCCACGCCG No data
Right 1005710992 6:28502618-28502640 ACCCAACAGCTCATTGAGAACGG 0: 1045
1: 721
2: 149
3: 73
4: 160
1005710984_1005710994 13 Left 1005710984 6:28502583-28502605 CCCTCTGCTCGGCCGCCACGCCG No data
Right 1005710994 6:28502619-28502641 CCCAACAGCTCATTGAGAACGGG 0: 1398
1: 571
2: 139
3: 41
4: 130
1005710984_1005710996 28 Left 1005710984 6:28502583-28502605 CCCTCTGCTCGGCCGCCACGCCG No data
Right 1005710996 6:28502634-28502656 AGAACGGGCCATGATGACAATGG 0: 692
1: 1062
2: 467
3: 273
4: 180

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1005710984 Original CRISPR CGGCGTGGCGGCCGAGCAGA GGG (reversed) Intergenic
No off target data available for this crispr