ID: 1005710994

View in Genome Browser
Species Human (GRCh38)
Location 6:28502619-28502641
Sequence CCCAACAGCTCATTGAGAAC GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 2279
Summary {0: 1398, 1: 571, 2: 139, 3: 41, 4: 130}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1005710989_1005710994 1 Left 1005710989 6:28502595-28502617 CCGCCACGCCGTCTGGGAGGTGT No data
Right 1005710994 6:28502619-28502641 CCCAACAGCTCATTGAGAACGGG 0: 1398
1: 571
2: 139
3: 41
4: 130
1005710990_1005710994 -2 Left 1005710990 6:28502598-28502620 CCACGCCGTCTGGGAGGTGTACC No data
Right 1005710994 6:28502619-28502641 CCCAACAGCTCATTGAGAACGGG 0: 1398
1: 571
2: 139
3: 41
4: 130
1005710983_1005710994 14 Left 1005710983 6:28502582-28502604 CCCCTCTGCTCGGCCGCCACGCC No data
Right 1005710994 6:28502619-28502641 CCCAACAGCTCATTGAGAACGGG 0: 1398
1: 571
2: 139
3: 41
4: 130
1005710985_1005710994 12 Left 1005710985 6:28502584-28502606 CCTCTGCTCGGCCGCCACGCCGT No data
Right 1005710994 6:28502619-28502641 CCCAACAGCTCATTGAGAACGGG 0: 1398
1: 571
2: 139
3: 41
4: 130
1005710991_1005710994 -7 Left 1005710991 6:28502603-28502625 CCGTCTGGGAGGTGTACCCAACA 0: 1065
1: 787
2: 161
3: 187
4: 172
Right 1005710994 6:28502619-28502641 CCCAACAGCTCATTGAGAACGGG 0: 1398
1: 571
2: 139
3: 41
4: 130
1005710984_1005710994 13 Left 1005710984 6:28502583-28502605 CCCTCTGCTCGGCCGCCACGCCG No data
Right 1005710994 6:28502619-28502641 CCCAACAGCTCATTGAGAACGGG 0: 1398
1: 571
2: 139
3: 41
4: 130

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1005710994 Original CRISPR CCCAACAGCTCATTGAGAAC GGG Intergenic
Too many off-targets to display for this crispr