ID: 1005710996

View in Genome Browser
Species Human (GRCh38)
Location 6:28502634-28502656
Sequence AGAACGGGCCATGATGACAA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 2674
Summary {0: 692, 1: 1062, 2: 467, 3: 273, 4: 180}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1005710995_1005710996 -9 Left 1005710995 6:28502620-28502642 CCAACAGCTCATTGAGAACGGGC 0: 1290
1: 604
2: 139
3: 40
4: 84
Right 1005710996 6:28502634-28502656 AGAACGGGCCATGATGACAATGG 0: 692
1: 1062
2: 467
3: 273
4: 180
1005710993_1005710996 -8 Left 1005710993 6:28502619-28502641 CCCAACAGCTCATTGAGAACGGG 0: 1295
1: 586
2: 145
3: 41
4: 71
Right 1005710996 6:28502634-28502656 AGAACGGGCCATGATGACAATGG 0: 692
1: 1062
2: 467
3: 273
4: 180
1005710984_1005710996 28 Left 1005710984 6:28502583-28502605 CCCTCTGCTCGGCCGCCACGCCG No data
Right 1005710996 6:28502634-28502656 AGAACGGGCCATGATGACAATGG 0: 692
1: 1062
2: 467
3: 273
4: 180
1005710991_1005710996 8 Left 1005710991 6:28502603-28502625 CCGTCTGGGAGGTGTACCCAACA 0: 1065
1: 787
2: 161
3: 187
4: 172
Right 1005710996 6:28502634-28502656 AGAACGGGCCATGATGACAATGG 0: 692
1: 1062
2: 467
3: 273
4: 180
1005710989_1005710996 16 Left 1005710989 6:28502595-28502617 CCGCCACGCCGTCTGGGAGGTGT No data
Right 1005710996 6:28502634-28502656 AGAACGGGCCATGATGACAATGG 0: 692
1: 1062
2: 467
3: 273
4: 180
1005710985_1005710996 27 Left 1005710985 6:28502584-28502606 CCTCTGCTCGGCCGCCACGCCGT No data
Right 1005710996 6:28502634-28502656 AGAACGGGCCATGATGACAATGG 0: 692
1: 1062
2: 467
3: 273
4: 180
1005710990_1005710996 13 Left 1005710990 6:28502598-28502620 CCACGCCGTCTGGGAGGTGTACC No data
Right 1005710996 6:28502634-28502656 AGAACGGGCCATGATGACAATGG 0: 692
1: 1062
2: 467
3: 273
4: 180
1005710983_1005710996 29 Left 1005710983 6:28502582-28502604 CCCCTCTGCTCGGCCGCCACGCC No data
Right 1005710996 6:28502634-28502656 AGAACGGGCCATGATGACAATGG 0: 692
1: 1062
2: 467
3: 273
4: 180

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1005710996 Original CRISPR AGAACGGGCCATGATGACAA TGG Intergenic
Too many off-targets to display for this crispr