ID: 1005716804

View in Genome Browser
Species Human (GRCh38)
Location 6:28557246-28557268
Sequence AATGCCACTCCCATTTGTAT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1005716804_1005716809 27 Left 1005716804 6:28557246-28557268 CCAATACAAATGGGAGTGGCATT No data
Right 1005716809 6:28557296-28557318 GAGCATGACATGGAAGATTTGGG No data
1005716804_1005716808 26 Left 1005716804 6:28557246-28557268 CCAATACAAATGGGAGTGGCATT No data
Right 1005716808 6:28557295-28557317 AGAGCATGACATGGAAGATTTGG No data
1005716804_1005716807 17 Left 1005716804 6:28557246-28557268 CCAATACAAATGGGAGTGGCATT No data
Right 1005716807 6:28557286-28557308 TAACTGATTAGAGCATGACATGG No data
1005716804_1005716810 28 Left 1005716804 6:28557246-28557268 CCAATACAAATGGGAGTGGCATT No data
Right 1005716810 6:28557297-28557319 AGCATGACATGGAAGATTTGGGG No data
1005716804_1005716811 29 Left 1005716804 6:28557246-28557268 CCAATACAAATGGGAGTGGCATT No data
Right 1005716811 6:28557298-28557320 GCATGACATGGAAGATTTGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1005716804 Original CRISPR AATGCCACTCCCATTTGTAT TGG (reversed) Intergenic
No off target data available for this crispr