ID: 1005719914

View in Genome Browser
Species Human (GRCh38)
Location 6:28590934-28590956
Sequence ACATCAACAAAGTGGAAAGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 556
Summary {0: 1, 1: 0, 2: 5, 3: 42, 4: 508}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1005719914_1005719918 23 Left 1005719914 6:28590934-28590956 CCTTCTTTCCACTTTGTTGATGT 0: 1
1: 0
2: 5
3: 42
4: 508
Right 1005719918 6:28590980-28591002 AGTGTTCTCCCTTTTCCTAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1005719914 Original CRISPR ACATCAACAAAGTGGAAAGA AGG (reversed) Intronic
900283651 1:1888985-1889007 ATATCAAGAAAGTGGATAGGCGG - Intronic
901618779 1:10564248-10564270 ACATAAAGAACATGGAAAGAAGG - Intronic
902143449 1:14376306-14376328 AAAGCAACAGAGTTGAAAGATGG + Intergenic
902775888 1:18674695-18674717 CCATCAGCACAGTGGAAAAAGGG - Intronic
902872204 1:19321011-19321033 CCATCAAGAAAGTGAAAAGACGG - Intronic
903605302 1:24571174-24571196 ACATTAAAAAAGTAAAAAGAAGG + Intronic
904649740 1:31996052-31996074 ACATCAACAAAGTGTCAAGTGGG + Intergenic
904912191 1:33943536-33943558 ACATTAACAAAATGAACAGAGGG - Intronic
905195834 1:36276558-36276580 GCATCAAGAAAGTGTAAAGCTGG + Intronic
907427074 1:54386576-54386598 AGAAAAACAAAGTGGGAAGAAGG + Intronic
908309953 1:62871004-62871026 CCATCAACAAAGTAAAAAGATGG - Intergenic
908792842 1:67800275-67800297 TCATCAGCAAAGTCGAAATATGG + Intronic
909403935 1:75264994-75265016 ACACCAACAAACTAGAAAAATGG + Intronic
909874176 1:80781430-80781452 AAAGAAACAAAGTGGAAAGCTGG + Intergenic
910560959 1:88590362-88590384 AAATCAACAAAATAGAAAGTTGG + Intergenic
910589570 1:88915525-88915547 AAATCAACAAAATGAAAAGTTGG - Intergenic
910601884 1:89041224-89041246 ACATCTGCCAAGTGGAAAAAAGG + Intergenic
910797294 1:91110960-91110982 AAATCAACAAAATGAAAAGTTGG + Intergenic
911326447 1:96474620-96474642 ACGGCAACAGAGTGGAAAGAGGG + Intergenic
912464994 1:109866257-109866279 ACCTCACCAAAGTAGATAGATGG + Intergenic
912604261 1:110972276-110972298 AAATAAGCAAAGAGGAAAGAGGG - Intergenic
913362112 1:117992832-117992854 ACATAAATAAAGAGGAAAGCAGG - Intronic
914327211 1:146631046-146631068 ACATCACCAAAGTGCAGAGCTGG - Intergenic
914345095 1:146792133-146792155 ACACAAATAAAGTAGAAAGAAGG - Intergenic
915033146 1:152901410-152901432 AAATCAACCAATAGGAAAGAAGG + Intergenic
915521920 1:156450925-156450947 TTATCAATAAAGTGGAAACAAGG - Intergenic
915710423 1:157892902-157892924 ACATCAAGTAAGTAGTAAGAAGG - Intronic
915892211 1:159782687-159782709 ACTTCTAGAAAGTGGAAGGATGG + Intergenic
916175199 1:162032121-162032143 GTAGAAACAAAGTGGAAAGAGGG + Intergenic
916727896 1:167539854-167539876 AAAAAAAAAAAGTGGAAAGAGGG - Intronic
917072714 1:171169675-171169697 ACATAAACAGAGTAGAAAGGTGG - Intergenic
918215040 1:182386104-182386126 ACATCACCAAAGTCCAAAAATGG - Intronic
918292791 1:183125023-183125045 ACATTAAAAAAGTATAAAGAAGG + Intronic
918383038 1:183976171-183976193 ACATTACCAAGGTGCAAAGAAGG + Intronic
919124254 1:193377106-193377128 CCATGAACAAAGTGGGAAGGAGG - Intergenic
919157510 1:193786040-193786062 ACATAAACAAACTGGAAAGCTGG + Intergenic
919462781 1:197898488-197898510 ACAAAAACAAAATGGAAAGATGG + Intergenic
919583297 1:199404597-199404619 AATTCAAAAGAGTGGAAAGAAGG + Intergenic
919780521 1:201217898-201217920 ACATCCATAAAGTGGAGAGGAGG + Intronic
920610852 1:207436327-207436349 CTATCAACAAAGTGAACAGACGG + Intergenic
921005101 1:211085456-211085478 AGAACAACAAAGTGGATAGTGGG + Intronic
921461263 1:215430067-215430089 AGATCAACAAAATAGATAGATGG - Intergenic
921663986 1:217844487-217844509 ACAGCCACAAGGAGGAAAGAAGG - Intronic
921926833 1:220717658-220717680 ACATCAGAACAGTGGAAAAAGGG - Intergenic
922112335 1:222572966-222572988 CCATCAAGATAGTGAAAAGAAGG + Intronic
922229271 1:223671647-223671669 ACAGCAAGAAAATGGCAAGAAGG + Intergenic
923351402 1:233110356-233110378 ACATCTATAAAGTGCTAAGATGG + Intronic
923799065 1:237189076-237189098 ACAGAAACAAAGTAGAAAGGTGG - Intronic
923868873 1:237969598-237969620 AGAGAACCAAAGTGGAAAGAGGG + Intergenic
923977413 1:239278919-239278941 ACATCAAGAACCTGGAAAAAAGG + Intergenic
924805847 1:247360959-247360981 ACAACAAAAAAGTGAACAGATGG + Intergenic
924941364 1:248814328-248814350 ACAGAATCAAAGTTGAAAGAAGG + Intronic
1063611098 10:7562816-7562838 ACATCCACAGAGGGGAGAGAAGG - Exonic
1064362487 10:14678529-14678551 TCATCAACAAAGAGGACAGATGG + Intronic
1065832322 10:29626003-29626025 ACAGAAACAAAATGGAAAGGTGG + Intronic
1065884202 10:30062510-30062532 GAATTAACAAAGAGGAAAGAGGG + Intronic
1066310155 10:34188242-34188264 AGATCAACAAAGAGGCAAGGAGG + Intronic
1067707275 10:48617878-48617900 ATATCAACAAAATGAAAAGTTGG + Intronic
1067856850 10:49801596-49801618 CCATCAAGAAAGTGAAAAGATGG - Intergenic
1068514422 10:58008453-58008475 ACAGCAACACAGAGGGAAGAAGG + Intergenic
1068949636 10:62764222-62764244 ACCTCAGCACTGTGGAAAGAAGG - Intergenic
1069060629 10:63891079-63891101 ACAGGGACAAAGGGGAAAGAAGG - Intergenic
1069126141 10:64636764-64636786 ACATCAGCAAAGTGGAAGCATGG - Intergenic
1069460130 10:68586937-68586959 ACATGAATAAAATGGCAAGATGG - Intronic
1070083874 10:73215520-73215542 ATATCAAAAAAGTAGAAAGATGG - Intronic
1070180224 10:74006312-74006334 ACATCCACACAGTGGAAAATTGG + Intronic
1070438712 10:76420557-76420579 AAACCAACAAACTGGAATGAAGG - Intronic
1070854638 10:79596999-79597021 ATATCAACAAAATGAAAAGTTGG + Intergenic
1071040553 10:81303669-81303691 CCATCAACAAAGTAAACAGATGG + Intergenic
1073257879 10:102166311-102166333 ATAAAAACAAAGTAGAAAGATGG - Intergenic
1073858612 10:107708883-107708905 ACTTCAACAATGTGAAAATAAGG - Intergenic
1073897704 10:108182489-108182511 CAATCAACAAAGTGAAGAGATGG - Intergenic
1074466752 10:113690599-113690621 ACATCCATAAGGTGGAAAAAAGG - Intronic
1074674974 10:115837845-115837867 ACCAAAACAAAGTGGAAGGAAGG + Intronic
1075496652 10:122926385-122926407 AAATCAACAAAATGAAAAGCTGG + Intergenic
1075498205 10:122946656-122946678 ACAACAACAAAGTGGTCAAAAGG + Intronic
1075867216 10:125734621-125734643 ATATTAACAAAGTGGTAACAAGG - Intronic
1075870013 10:125765055-125765077 ACAACAACCAAGTGGACAAATGG - Intergenic
1076047741 10:127308099-127308121 ACATCAACAGAATTGAAGGAAGG - Intronic
1076174031 10:128351823-128351845 ATTTCATCAAGGTGGAAAGATGG + Intergenic
1078237016 11:9494684-9494706 ATCTCAACAGAGTGGAGAGAAGG + Exonic
1079366275 11:19813054-19813076 ACCTCTACAAAGTTGAATGAAGG + Intronic
1079800416 11:24861175-24861197 AAATCAACCAAGTGGAAGAAAGG + Intronic
1079930186 11:26549100-26549122 AAATGAACAAAGAGGAATGAAGG + Intronic
1080350279 11:31376339-31376361 ACATCAACCAAGAAAAAAGAAGG - Intronic
1081379464 11:42396753-42396775 AGATCAACAAAAGGCAAAGAAGG + Intergenic
1082134847 11:48535660-48535682 AAATCAAAATAGTGGAAAGTTGG - Intergenic
1085160015 11:74331967-74331989 GAATAAACAAAGAGGAAAGATGG + Exonic
1085968886 11:81563320-81563342 TCTTCAATAAAGGGGAAAGAAGG - Intergenic
1086138563 11:83468380-83468402 ACATGAACAAAGAGGAAAATAGG + Intronic
1086139464 11:83479229-83479251 GCAGCACAAAAGTGGAAAGATGG - Intronic
1086518648 11:87645584-87645606 ATAACAACAAAGTGAAAAGGTGG - Intergenic
1086623742 11:88920093-88920115 ACATCAATGAAATGAAAAGATGG + Intronic
1086927687 11:92657981-92658003 ACATTAAAAAAGTGAAAAAAAGG + Intronic
1087013797 11:93537408-93537430 ACAGGAACAAAATGGAAAAAAGG + Intronic
1087183666 11:95162689-95162711 ACTTCAATCAAGTGGTAAGAAGG + Intergenic
1087472759 11:98598349-98598371 ATATCAACAAAATGGAAATTTGG - Intergenic
1087601622 11:100323777-100323799 ACCTAAATAAAGTAGAAAGAAGG - Intronic
1087842728 11:102936556-102936578 ACGTCAACCAAACGGAAAGAAGG + Intergenic
1088455079 11:110024859-110024881 AAATCAACAATTTGGGAAGATGG - Intergenic
1088463589 11:110109537-110109559 CCATTAACAAAATGGAAAGCTGG - Intronic
1088686851 11:112290843-112290865 ACATTCACAAAGTGGATACAGGG - Intergenic
1088904697 11:114145984-114146006 AAATCAACAAAATGCAATGATGG + Intronic
1092629931 12:10366142-10366164 ACATAAGCCAAGAGGAAAGATGG + Intergenic
1092907563 12:13115751-13115773 AAATGGACAAAGTGGCAAGAAGG - Intronic
1093293262 12:17355563-17355585 TGATCAACTAAGGGGAAAGAGGG + Intergenic
1093655228 12:21687336-21687358 ACATTAAGAGAGTGGAAGGAAGG + Intronic
1093665299 12:21805185-21805207 TCATCACCAAAGTGGAAAAGAGG + Intronic
1093902963 12:24657299-24657321 AGATCAACAAAATGAAAAGTAGG - Intergenic
1094173195 12:27516073-27516095 TCATCTGCAAAGTGGAAACAGGG + Intergenic
1094275472 12:28669807-28669829 AAATCAACCAAGTGGAAAAAAGG + Intergenic
1094741949 12:33299773-33299795 AAATCAACAAAGTTAAAAGTTGG + Intergenic
1094837709 12:34329896-34329918 ACACCACCAAAGTGGCAAGAAGG - Intergenic
1095815106 12:46412792-46412814 ACATCTCCAAAGAGAAAAGAAGG + Intergenic
1096107979 12:49009413-49009435 AAATCAACAAAGTAGAAAATAGG - Intronic
1097502196 12:60418521-60418543 ACAACAAAAATGTGGAAACATGG + Intergenic
1097940540 12:65299779-65299801 ATAGCAACAAAATGTAAAGAAGG - Intronic
1098649375 12:72944904-72944926 AGATCAAGAAAGGGGAAAGAAGG + Intergenic
1098696087 12:73557340-73557362 GGATAAACAAAGTAGAAAGATGG + Intergenic
1098896385 12:76066491-76066513 CCAACAAGAAAGTGGAAAAAGGG + Intronic
1099293444 12:80801289-80801311 ACAACAACAAAAGTGAAAGAGGG + Intronic
1099978084 12:89567354-89567376 AGAGCAACAGAATGGAAAGATGG + Intergenic
1100865837 12:98855690-98855712 ACATCATCAATGTGAAAAGCTGG + Intronic
1101653938 12:106703294-106703316 CCATCTACAATGTGGAAAGCCGG - Intronic
1101798128 12:107996176-107996198 AGATCAACAAAATGAAAAGTTGG - Intergenic
1102070595 12:110015849-110015871 ACATTAAGAAAGTGAACAGATGG - Intronic
1102103996 12:110304704-110304726 CCATCAAGAAAGTGAAAAAAAGG - Intronic
1103061273 12:117860580-117860602 TCACCAACGAGGTGGAAAGATGG - Intronic
1103816818 12:123664798-123664820 AGATCAACAAAATGAAAAGCTGG - Intergenic
1103876198 12:124129272-124129294 ACAACAACAAAATGTAAACAGGG - Intronic
1104091942 12:125524973-125524995 ACATTAGCCAAGTGGAAAGAAGG + Intronic
1104171672 12:126287584-126287606 ACTTGAACAAAATGAAAAGAGGG + Intergenic
1104701904 12:130911514-130911536 TCATAAACAAAGGCGAAAGAAGG + Intergenic
1105433053 13:20354811-20354833 ACATGAATCATGTGGAAAGATGG - Intergenic
1106254208 13:28007961-28007983 AAATGAACAAAGCAGAAAGAAGG - Intronic
1109410178 13:61954562-61954584 ATATCAAAAATGTGGAATGAAGG - Intergenic
1109481979 13:62967053-62967075 ACTTCAACAAAGTAGAAATTTGG - Intergenic
1109608216 13:64727490-64727512 AAATTAACAAAGTTGATAGATGG - Intergenic
1111024190 13:82497922-82497944 CCATCAAGAAAGTGGAAAGAAGG - Intergenic
1111994538 13:95151498-95151520 AGAAGAACAAAGAGGAAAGAAGG + Intronic
1114643001 14:24237126-24237148 ACATCATCAAAGTGGGAATTGGG + Exonic
1114821722 14:26028522-26028544 GTATCAACAAAGTAGAAAGTCGG + Intergenic
1115221013 14:31058415-31058437 ACATCAAGGAAGAAGAAAGAAGG - Intronic
1115937732 14:38573543-38573565 ACAAAAACAAAGTGGAGAAAGGG - Intergenic
1116561090 14:46379384-46379406 ACATTAAGAAAGTGAAAAGGTGG - Intergenic
1117444377 14:55789414-55789436 GCTTCACCAAAGTGCAAAGAGGG + Intergenic
1118964774 14:70570325-70570347 GCATCAACAAAATGAAAAGCTGG + Intergenic
1119547900 14:75486412-75486434 AAAGAAACAAAGAGGAAAGAAGG + Intergenic
1120439397 14:84516958-84516980 AGATCAACAAAGTGAAAAACTGG - Intergenic
1120852782 14:89186311-89186333 AAAACAACAAAATGGAACGAGGG - Intronic
1120921919 14:89763201-89763223 GTATCAACACAGGGGAAAGATGG - Intergenic
1121809469 14:96869292-96869314 TCATCAAGAAACTAGAAAGATGG - Intronic
1123715023 15:23021615-23021637 ACAGAAACAAAGTGGAATGCTGG - Intronic
1126126627 15:45299848-45299870 ACATGAACAAAGAGGAAATTTGG + Intergenic
1126236405 15:46390360-46390382 ACATGAACATGGTGGAATGATGG - Intergenic
1126960663 15:53990682-53990704 AAATGAACAAAGTGGCAAGATGG - Intergenic
1127356151 15:58202184-58202206 TCATCAAGAAAGTGAAAAGATGG + Intronic
1127739622 15:61889709-61889731 ACAGAAACAAATTGGAAAAAAGG - Intronic
1127852136 15:62923159-62923181 GAATAAACAAAGTGGAAGGAAGG - Intergenic
1128628019 15:69231660-69231682 ACAACAACAAAATGAAATGAGGG - Intronic
1129140260 15:73591541-73591563 AAATCTACCCAGTGGAAAGATGG + Intronic
1130056911 15:80533881-80533903 ACATCAGGAAAATGGAATGAGGG - Intronic
1130110578 15:80960448-80960470 AATTACACAAAGTGGAAAGAAGG + Intronic
1131209597 15:90482480-90482502 ACATCAAACAAGTAGAAAGATGG + Intronic
1133495802 16:6315785-6315807 ACTTCAAAATATTGGAAAGAGGG - Intronic
1133951317 16:10396050-10396072 AGTTCAACAAAGTTGAAGGATGG + Intronic
1134396302 16:13867232-13867254 ACAACAAAAAATTGGAAACACGG - Intergenic
1134693549 16:16206650-16206672 ACAGAAAGAAAGGGGAAAGATGG - Intronic
1134978302 16:18588050-18588072 ACAGAAAGAAAGGGGAAAGATGG + Intergenic
1135898242 16:26430205-26430227 ACATCAACATATTTTAAAGATGG + Intergenic
1136064905 16:27752050-27752072 AAAAAAACAAAGTAGAAAGATGG - Intronic
1139309552 16:66016995-66017017 ACATCAATCAAGTGAATAGAGGG + Intergenic
1139836711 16:69844942-69844964 GCAACAGCAAAGTGGAAAGGGGG - Intronic
1139988899 16:70923163-70923185 ACACAAATAAAGTAGAAAGAAGG + Intronic
1140006349 16:71079893-71079915 ACATCACCAAAGTGCAGAGCTGG + Exonic
1140542965 16:75776577-75776599 AAATCAACAAAATGGAAAGTTGG + Intergenic
1140629076 16:76830306-76830328 ATAACAACAAAGTAGAAAGGTGG + Intergenic
1141149372 16:81553361-81553383 AAAGCAACAAAGTTGAAAGCAGG + Intronic
1141364699 16:83431985-83432007 CCCTCAACAAAGTGGCCAGAAGG - Intronic
1142337026 16:89496027-89496049 ACAACAACAAAAAAGAAAGACGG - Intronic
1144612860 17:16739404-16739426 CCATCAAGAAAGTGAAAAGGAGG - Intronic
1144899925 17:18576183-18576205 CCATCAAGAAAGTGAAAAGGAGG + Intergenic
1145132519 17:20369482-20369504 CCATCAAGAAAGTGAAAAGGAGG - Intergenic
1145184948 17:20785958-20785980 ATAGCAACAAAGTGAAAAGGAGG - Intergenic
1146588556 17:34106220-34106242 ACATCACCAATGAGGGAAGATGG - Intronic
1148292013 17:46460490-46460512 ACATCAAGAAAAAGAAAAGATGG + Intergenic
1148314201 17:46678181-46678203 ACATCAAGAAAAAGAAAAGATGG + Intronic
1149023687 17:51999659-51999681 CCATCATCAAAGTTGAAAGCTGG + Intronic
1149095521 17:52835746-52835768 AAGTCAACAAAATGGAAAGCTGG + Intergenic
1149229554 17:54517924-54517946 AAATCAACCAAGTGGAAGAAAGG - Intergenic
1149385239 17:56136512-56136534 TGATCAACAGAGTGGAAACAGGG + Intronic
1149743121 17:59067473-59067495 TCATCAACAAAGGGAAAAAAGGG + Intronic
1150216435 17:63473522-63473544 CCATCAAGAAAATGAAAAGACGG - Intergenic
1150947327 17:69762186-69762208 ACAACAACAAAGTAAACAGAGGG - Intergenic
1151335684 17:73438271-73438293 GCATCTACAAAGTGGCAGGAAGG - Intronic
1153099409 18:1449523-1449545 AAATCAATAAAGTGGAAAACAGG - Intergenic
1154246128 18:12701463-12701485 ACATCTACTAAGTTGAAAGCTGG - Intronic
1154296487 18:13154681-13154703 AAATCAACAAAATGAAAAGTTGG - Intergenic
1155011367 18:21781955-21781977 ATATCAACAAAATGAAAAGCTGG - Intronic
1155240744 18:23861634-23861656 ATATCCACAAACTGGAAAGAGGG - Exonic
1155568235 18:27161025-27161047 AGATCAACAAAATTGATAGACGG - Intronic
1155958872 18:31977219-31977241 ACATTAACAAAGAGGTAAAATGG + Intergenic
1156544756 18:37953456-37953478 ACAAAAACATAGGGGAAAGAGGG + Intergenic
1156608644 18:38699644-38699666 ATATCAACAAAAATGAAAGAGGG - Intergenic
1157398543 18:47365805-47365827 ACATCAAAAACGTAGAAAGATGG - Intergenic
1158226596 18:55207765-55207787 CCATCAACCAAGTGAAAAAATGG + Intergenic
1158279143 18:55801718-55801740 AGATCAACAAAATTGATAGACGG - Intergenic
1158431620 18:57393194-57393216 AGATCAACAAAATGCAAAGTTGG + Intergenic
1158647433 18:59259852-59259874 AGATCAACAAAATTGATAGATGG + Intergenic
1159680396 18:71343037-71343059 ACCTGAACAACATGGAAAGAAGG - Intergenic
1160258655 18:77269402-77269424 ATATCTATTAAGTGGAAAGAAGG + Exonic
1160525924 18:79536488-79536510 ACACCAACAAAGGAGAAAAAGGG - Intergenic
1163046518 19:14646727-14646749 AAAGAAACAAAGAGGAAAGAAGG - Intronic
1163129182 19:15261596-15261618 ACAACACCAAAGTGAAGAGAGGG + Intronic
1164053883 19:21605978-21606000 ATATAAACCAAGAGGAAAGATGG + Intergenic
1164110975 19:22158438-22158460 AGATCAACAAAATTGATAGATGG - Intergenic
1164331738 19:24265408-24265430 AGATCAACAAAATTGATAGACGG - Intergenic
1164543028 19:29135803-29135825 AGATCAACAAAATTGATAGACGG + Intergenic
1165051798 19:33146525-33146547 CCATCAAAAAAAAGGAAAGAAGG - Intronic
1165684016 19:37802404-37802426 AGAAAAACAAAGAGGAAAGAAGG + Intronic
1167760992 19:51449083-51449105 AAATGAAAAAAGTGGAAACAGGG + Intergenic
925336713 2:3103942-3103964 ACATCAAAAAAGAGGATGGATGG + Intergenic
926565933 2:14474209-14474231 ACATCAACAAAAATAAAAGATGG + Intergenic
927910215 2:26892230-26892252 ACCTCCACAAAGTGGGAACAAGG - Intronic
928460900 2:31471596-31471618 AGAGAAACAAAATGGAAAGAAGG + Intergenic
928474276 2:31609772-31609794 CCATCAGGAAAGTGAAAAGATGG + Intergenic
928490800 2:31780603-31780625 AGATCAAAAAAAGGGAAAGAAGG + Intergenic
929007219 2:37407605-37407627 ACATTAACAAAGTATAAAAATGG - Intergenic
929281366 2:40083682-40083704 AGATCAACAAAATGAAAAGTTGG - Intergenic
929727874 2:44450076-44450098 TCATCAACACTGTGGAATGAGGG + Intronic
931701630 2:64913781-64913803 ACATAAACGAAGTGAAAAAAAGG + Intergenic
931785522 2:65615159-65615181 ACATCAACTGAGTGAAAAAAAGG - Intergenic
933912449 2:86954932-86954954 AAATCACCAAAGTATAAAGATGG - Intronic
934010546 2:87814963-87814985 AAATCACCAAAGTATAAAGATGG + Intronic
934873621 2:97892144-97892166 ACACCAAGTAAATGGAAAGATGG - Intronic
935466944 2:103410113-103410135 ACATCAAGAAAATGAACAGATGG - Intergenic
935774120 2:106455668-106455690 AAATCACCAAAGTATAAAGATGG + Intronic
935798269 2:106666682-106666704 CCATCAAGAAAGTGAAAAGGTGG - Intergenic
935826476 2:106956155-106956177 AAATCAACATAGTGAAAACACGG - Intergenic
935877858 2:107531399-107531421 AAATTAATAAAGTGGAAAAAGGG - Intergenic
935905948 2:107840245-107840267 AAATCACCAAAGTATAAAGATGG - Intronic
935992422 2:108732757-108732779 AAATCACCAAAGTATAAAGATGG - Intronic
936127738 2:109805412-109805434 AAATCACCAAAGTATAAAGATGG - Intronic
936216959 2:110566073-110566095 AAATCACCAAAGTATAAAGATGG + Intronic
936346325 2:111678060-111678082 AAATCAGCAAAGTACAAAGAAGG - Intergenic
936426097 2:112420657-112420679 AAATCACCAAAGTATAAAGATGG + Intronic
936450522 2:112630564-112630586 ACATGAACAAAATGAAAACATGG + Intergenic
937604343 2:123779197-123779219 ACATGAACAAAGTAGAGAGATGG - Intergenic
937729172 2:125206497-125206519 ATATCACCAAAATTGAAAGATGG - Intergenic
938272529 2:129986544-129986566 TCATCAGCAAAGAGCAAAGATGG + Intergenic
938323530 2:130381680-130381702 CCATCATCACAGTGAAAAGACGG + Intergenic
938562081 2:132482040-132482062 ACGTCAACAATGTTGAGAGAAGG - Intronic
939627162 2:144491898-144491920 ACAGCTACAAAATGTAAAGAAGG - Intronic
939744193 2:145949096-145949118 AGATCAACAAAATTGATAGACGG - Intergenic
939841388 2:147192602-147192624 TCATCCAAAAATTGGAAAGAAGG + Intergenic
940395918 2:153191998-153192020 AGATCAACAAAATGAAAAGTTGG - Intergenic
940402028 2:153258405-153258427 AGATCAACAAAATGAAAAGTTGG - Intergenic
940552554 2:155179273-155179295 ACATAAGGAAAGTAGAAAGAGGG + Intergenic
940677902 2:156747051-156747073 ACAGAAACAAAGAGAAAAGAGGG + Intergenic
941332014 2:164190123-164190145 AGATGAAAGAAGTGGAAAGATGG + Intergenic
941459872 2:165756939-165756961 ACATCAAAAAATTTGAAAGTAGG - Intronic
941519623 2:166523751-166523773 ACAGGAACAAAAAGGAAAGATGG - Intergenic
941529825 2:166654139-166654161 ACATCAACAGAGTGAAGAGATGG - Intergenic
941707082 2:168670552-168670574 CCATCCACACAGAGGAAAGAAGG - Intronic
941995011 2:171594110-171594132 ACCTAAAGAAAGTGGAAGGATGG + Intergenic
942137309 2:172939439-172939461 ACCTCAACAAAGAAGACAGATGG - Intronic
942956401 2:181779341-181779363 ACATCTTCAAAGAGAAAAGATGG - Intergenic
945187576 2:207155302-207155324 AGATTAGCCAAGTGGAAAGAGGG + Intronic
945500062 2:210561396-210561418 ACATGAGCAAATTGGAATGAGGG - Intronic
946219224 2:218212144-218212166 ACAGAGACAAAGTGGAGAGAAGG + Intergenic
946316104 2:218913902-218913924 CCATCAAGAAAGTGAAAACAGGG - Intergenic
946548606 2:220775589-220775611 TCATCAACAAAGTGCAAATTAGG + Intergenic
947856422 2:233327432-233327454 ACTTCAACAAAGGGGAAACCCGG - Intronic
1171507920 20:25653992-25654014 AAATCAACAAAATGAAAAGGTGG - Intergenic
1172298009 20:33827265-33827287 TCAACAACAAAATGGGAAGATGG + Intronic
1172961273 20:38801833-38801855 ACAGCTAAAAAGTGGAAACAAGG - Intergenic
1173077823 20:39836947-39836969 ACAACAACAAAATGTAAAAATGG - Intergenic
1173245391 20:41334262-41334284 GCATCAACAATGTGGACAGAGGG + Intergenic
1173267645 20:41499912-41499934 CCAGCTACAAAGGGGAAAGATGG - Intronic
1173441583 20:43082008-43082030 ACATCAAAAAAGATGAAAAATGG - Intronic
1174925445 20:54754352-54754374 AGATCAACAAAATTGATAGATGG + Intergenic
1175207955 20:57326468-57326490 ACATCCAAAAAAGGGAAAGAAGG - Intergenic
1176263055 20:64193246-64193268 AGATCAAGAGAGTGGAAAGCAGG + Intronic
1176422902 21:6530793-6530815 CCATTTCCAAAGTGGAAAGACGG - Intergenic
1177336498 21:19735055-19735077 ACATCAGCAAAGAGGACATATGG - Intergenic
1178008428 21:28252411-28252433 AAATAAATAAAGAGGAAAGAAGG + Intergenic
1178894348 21:36546561-36546583 AGTTCAACAGAGGGGAAAGAAGG - Intronic
1179004593 21:37500906-37500928 AAATCAACAAAGTCAAAAGCTGG - Intronic
1179362208 21:40720843-40720865 GAATTTACAAAGTGGAAAGAAGG + Intronic
1179566008 21:42249673-42249695 AAATCAAAAAAGTAAAAAGACGG + Intronic
1179698396 21:43139110-43139132 CCATTTCCAAAGTGGAAAGACGG - Intergenic
1180250462 21:46582752-46582774 TTACCAGCAAAGTGGAAAGATGG - Intergenic
1182024144 22:27104230-27104252 ACATCTGTAAAATGGAAAGAAGG - Intergenic
1182247730 22:28973278-28973300 CCATCAAGAAAGTGTAAAAAAGG - Intronic
1182777776 22:32843605-32843627 ACACCAAAAAGGAGGAAAGAGGG - Intronic
1182836062 22:33342298-33342320 ACTTAAACTAAGTGAAAAGAAGG + Intronic
1183185307 22:36288426-36288448 ACATCAACAACTTGGGAAGCTGG + Intronic
1184937233 22:47733947-47733969 ACATAAACAAAATTTAAAGAAGG + Intergenic
949111023 3:260492-260514 ACATCATCATAGTCGAAACAAGG - Intronic
949675331 3:6447187-6447209 AAACCAACAGAGTGGAAAGCAGG - Intergenic
949925154 3:9035309-9035331 AATTCTACAAAGTGGAAAAAAGG + Intronic
951074353 3:18370998-18371020 GCATCAACAAACTGGTAATAAGG + Intronic
951475992 3:23106816-23106838 ACATCAAAGGAGTGGAAAGTAGG - Intergenic
951994289 3:28709956-28709978 ACCTGAACGAAGTGTAAAGAAGG + Intergenic
953118192 3:40013513-40013535 GCAGCAACATACTGGAAAGAGGG + Intronic
953711896 3:45279605-45279627 AGATCAACAAAATGAAAAGTTGG + Intergenic
954703415 3:52464966-52464988 CCATCAAGAAAATGAAAAGATGG - Intronic
954949407 3:54457036-54457058 AGATCAACAAAATGAAAAGTTGG - Intronic
955258243 3:57357041-57357063 ACATTAAAAATGTGGAAAAATGG - Intronic
955443950 3:58987455-58987477 ATATTACAAAAGTGGAAAGAAGG + Intronic
955793626 3:62612797-62612819 ACATCAACAAATGGGAACAAAGG - Intronic
956968661 3:74494716-74494738 GCATCAACAAAGTGGTATAAAGG - Intronic
957584194 3:82113655-82113677 AAATCAACCAAGTGGAAGAAAGG - Intergenic
958268640 3:91470514-91470536 AAGTAAACAAACTGGAAAGATGG + Intergenic
958509020 3:95021690-95021712 GGATCAACAAAGTGAAAAGTTGG - Intergenic
958814303 3:98899911-98899933 ACATCTCTACAGTGGAAAGAAGG + Intronic
959001181 3:100965969-100965991 ACTTCAACCAAGGGCAAAGATGG + Intronic
959452856 3:106524246-106524268 AAATTGACAAAGTGGAAAAAAGG + Intergenic
959954959 3:112226419-112226441 ACATCAAAAAAATAGACAGAGGG + Intronic
960151831 3:114257249-114257271 CAATCAACAAAGTGAAGAGATGG - Intergenic
960688360 3:120316583-120316605 ACATCAAAAAGTTAGAAAGATGG + Intergenic
962817134 3:139011327-139011349 AGATCAACAAAATGAAAAGCTGG - Intronic
963443955 3:145378157-145378179 AGATCAACAAAATGAAAAGTTGG + Intergenic
963459490 3:145590750-145590772 CAATCAACAAAGTGAAGAGATGG + Intergenic
964462284 3:156947064-156947086 AGATCAACAAAATGAAAAGTTGG - Intronic
964799089 3:160533718-160533740 ACATTAACACAGTGAAAAAAAGG + Intronic
965670244 3:171140491-171140513 ACAGCAACAAAGGCGAGAGAAGG - Exonic
966152997 3:176885511-176885533 AGATCAACAAAATGAAAAGTTGG + Intergenic
966563094 3:181345421-181345443 GCTTCACCAAAGTAGAAAGATGG + Intergenic
966638147 3:182158341-182158363 AATTCAACAAAATTGAAAGAGGG - Intergenic
966760670 3:183416149-183416171 ATAGCAGCAAAGTGGGAAGAAGG - Intronic
969579127 4:8053807-8053829 TCATGAACAAAGAGGAAAAAGGG - Intronic
969834764 4:9831636-9831658 CCATCTGCAAAATGGAAAGAGGG + Intronic
970806374 4:20039572-20039594 ACAACCACAAAGAAGAAAGATGG - Intergenic
971663781 4:29455954-29455976 ACATCCACAAACTAGAAGGAGGG + Intergenic
971868337 4:32203098-32203120 ACAACAACAAACTCTAAAGAAGG - Intergenic
972185782 4:36526304-36526326 GGATCAACAAAGTGAAAAGTTGG - Intergenic
972442424 4:39107626-39107648 ATCTGAACACAGTGGAAAGATGG + Exonic
972589284 4:40469279-40469301 ACATCATAAAAAGGGAAAGAAGG + Intronic
972589339 4:40469759-40469781 ACATCATAAAAAGGGAAAGAAGG - Intronic
973005426 4:44999463-44999485 ACAACAATAAAATGGAAAGAGGG + Intergenic
973634379 4:52848463-52848485 AAATCACCTAAGTGGAAAGCAGG - Intergenic
974265870 4:59585105-59585127 AGATCAACAAAATAGATAGACGG + Intergenic
975775714 4:77784782-77784804 AAATCAAAAAAGTGGAAAGAAGG - Intronic
976025049 4:80676893-80676915 ATATCAACAAAATGAAAAGTTGG - Intronic
976082508 4:81371559-81371581 AAATCAACAAAATGAAAAGTTGG - Intergenic
976760968 4:88548960-88548982 CCATTAAGAAAGTGAAAAGATGG - Intronic
977163204 4:93662276-93662298 AGAACAACAAAGCAGAAAGAGGG - Intronic
977401090 4:96533303-96533325 ACATGAAAAAAGTGGATAGAAGG - Intergenic
977672905 4:99716403-99716425 ACATGAACAAATTTGAAGGATGG - Intergenic
977754034 4:100644563-100644585 ACATGAAGAAAATGTAAAGAAGG + Intronic
978326824 4:107567370-107567392 AAATCAACAAAATGAAAAGTTGG + Intergenic
978834155 4:113127657-113127679 GCATGATCAAAGTGGAAGGAAGG + Intronic
978933965 4:114353584-114353606 AGATCAACAAAATGAAAAGTTGG - Intergenic
979934341 4:126672813-126672835 AGATCAACAAAATTGATAGACGG + Intergenic
980503703 4:133688093-133688115 AGATCAACAAAATTGATAGACGG - Intergenic
980711765 4:136578355-136578377 ACAACCACAAAGTGGGGAGAGGG + Intergenic
980787265 4:137571857-137571879 AAATCAACCAAGTGGAAGAATGG - Intergenic
981463822 4:145042567-145042589 ACATCAAAAAAGTAGAGAAAAGG - Intronic
981669473 4:147271087-147271109 AGATCAATAAAGTGGAGAGTTGG - Intergenic
982060122 4:151596793-151596815 ACATCAATCAAGTGGAAGAAAGG - Intronic
982426035 4:155262007-155262029 AGATCAACAAAATGAAAAGGGGG - Intergenic
982440990 4:155435810-155435832 ACATTAACCATGTGAAAAGAGGG - Intergenic
982580247 4:157168263-157168285 ACATTAAAAAAGTGGAGTGAGGG + Intronic
982941725 4:161567421-161567443 ATAACAAGAGAGTGGAAAGAAGG - Intronic
983464251 4:168067486-168067508 AGATCAACAAAATTGATAGATGG + Intergenic
983703584 4:170629387-170629409 ACAACAACCAAGAGGAAACAGGG - Intergenic
983879352 4:172915474-172915496 AGATCAACAAAATAGATAGATGG + Intronic
984054213 4:174906209-174906231 AGATCCACAAAATGAAAAGATGG - Intronic
986763733 5:10903989-10904011 ACAGCAACAAGGTCAAAAGAGGG - Intergenic
987013693 5:13795276-13795298 AGATCAACAAAATTGATAGACGG + Intronic
987250768 5:16099019-16099041 ACATCAAAAGAGTAGAAACAAGG - Intronic
987747162 5:21990263-21990285 ACAACAACAAAATTTAAAGATGG - Intronic
988367178 5:30315503-30315525 ACATTTACTAAGTGGAAACAGGG + Intergenic
991767339 5:70000025-70000047 ACAACAACAAAATTTAAAGATGG - Intergenic
991846575 5:70875103-70875125 ACAACAACAAAATTTAAAGATGG - Intergenic
992168815 5:74081928-74081950 AGATAAACAAATTGGTAAGAAGG + Intergenic
992416216 5:76554358-76554380 CCATTAAGAAAGTGAAAAGACGG + Intronic
993418745 5:87672495-87672517 ACATCTACTAAGTTGAAAGTTGG + Intergenic
993507319 5:88725836-88725858 ACATCAACAAAGTTGACGTATGG + Intronic
993791892 5:92219730-92219752 ACATGAACAAAGTGGCATGGTGG + Intergenic
994113140 5:96031111-96031133 TTAACAACAAAGTGGAAATATGG - Intergenic
994626591 5:102228111-102228133 ACATTATCAAAGTCCAAAGAAGG - Intergenic
995054975 5:107748936-107748958 ACATAAACAACTTGGAAGGAAGG - Intergenic
995169728 5:109093062-109093084 ACAGAAACAAAGTAGAATGATGG + Intronic
995869284 5:116727154-116727176 ACAAGAAGAAAGAGGAAAGAGGG - Intergenic
996616923 5:125453124-125453146 AAATCAACAGATGGGAAAGAGGG - Intergenic
996898519 5:128516019-128516041 AAGTCAAAAAAGTTGAAAGAAGG + Intronic
998338546 5:141395807-141395829 ACATGAACAAACTTTAAAGATGG + Intronic
998883340 5:146667920-146667942 AGAGAAACAAAGTGGGAAGAAGG + Intronic
999034239 5:148329420-148329442 AGATCAACAAAATTGATAGACGG - Intronic
999130039 5:149275488-149275510 AAATGAAGAAAGAGGAAAGAAGG - Intronic
999157568 5:149469425-149469447 ACATTAAAAAGGTGTAAAGAGGG + Intergenic
999660193 5:153853579-153853601 AAATCAACAAAATGAAAAGTTGG - Intergenic
999662178 5:153876544-153876566 AGATCAGCAATGTGGAAAAATGG - Intergenic
999907522 5:156158552-156158574 ACATGAACAGACTGGAGAGAAGG - Intronic
1000138243 5:158375249-158375271 ACATCAAAAAAGTTGACAAATGG + Intergenic
1001466713 5:171973570-171973592 ACAACAGCAAAGTGTAAGGATGG + Intronic
1001484109 5:172107260-172107282 ACATGAAAAAATTGGAAACACGG + Intronic
1001729393 5:173938934-173938956 ACTTCTAGAAAGAGGAAAGAAGG - Intronic
1003055996 6:2821095-2821117 ACATCATCAAAGAGCAAAGAGGG + Intergenic
1004370608 6:15049114-15049136 ACACCAACTAAGTGGAAAGTCGG + Intergenic
1005559227 6:27020680-27020702 CTAAGAACAAAGTGGAAAGAAGG - Intergenic
1005719914 6:28590934-28590956 ACATCAACAAAGTGGAAAGAAGG - Intronic
1006918941 6:37615116-37615138 GCCTCAGCAGAGTGGAAAGATGG - Intergenic
1007093241 6:39197455-39197477 GCAGCATCAAAGTGGAAAGTGGG + Intronic
1007112567 6:39321392-39321414 CCATCTACAAAGTGGAGATAGGG + Intronic
1007286167 6:40748974-40748996 ACTTGATCAAATTGGAAAGAGGG - Intergenic
1008741698 6:54616130-54616152 AAATCGACAAAGTGGAAGAAAGG + Intergenic
1008986568 6:57551073-57551095 AAGTAAACAAACTGGAAAGATGG - Intronic
1009174533 6:60443643-60443665 AAGTAAACAAACTGGAAAGATGG - Intergenic
1009303428 6:62056697-62056719 TCATCAATAAAGGGGAAAGAAGG - Intronic
1009780803 6:68267103-68267125 CCATCAACAAAATGAAAAGCTGG + Intergenic
1010025430 6:71210573-71210595 ATATCAAGAAAGTAAAAAGAAGG - Intergenic
1010595466 6:77757764-77757786 ACATAAATAAAGGGGAAATACGG - Intronic
1011103021 6:83745262-83745284 AAATCAACAAAGTGTAAGGAAGG + Intergenic
1011302503 6:85891444-85891466 AAATCAATAAAGTGGAAGAAAGG - Intergenic
1011715527 6:90101190-90101212 CCATTAAGAAAGTGAAAAGATGG - Intronic
1011883717 6:92064191-92064213 ACAGAAACAAAATAGAAAGAAGG - Intergenic
1011912361 6:92456922-92456944 ACATCAACATATTTGAAATATGG + Intergenic
1011917744 6:92529699-92529721 ACATCAACAAAAGGAAAAGCTGG + Intergenic
1012598268 6:101065224-101065246 AGATCAACAAAATTGATAGATGG + Intergenic
1012992996 6:105945535-105945557 TCATAAGCAAACTGGAAAGATGG + Intergenic
1012999302 6:106006688-106006710 ACCTCAAAAAACTGGAAAGAAGG - Intergenic
1013168450 6:107615225-107615247 ACATAAACACAGAGGAAGGAAGG + Intronic
1013426919 6:110020721-110020743 ACATCAACAAAGATAACAGAAGG + Intergenic
1013711648 6:112907821-112907843 ATATAAACAAAGTAGAATGATGG - Intergenic
1014117298 6:117679846-117679868 GCATCAAGAAAGTGGAGAAATGG + Intronic
1014171093 6:118279915-118279937 ATTTTATCAAAGTGGAAAGATGG + Intronic
1014196823 6:118570158-118570180 ACCTCTACATAGTGGAAAGGGGG + Intronic
1014368239 6:120572416-120572438 AGATCAAACAAGAGGAAAGAAGG + Intergenic
1015212145 6:130710511-130710533 ACATGAACTAAGTAGAAACAAGG + Intergenic
1016155221 6:140798101-140798123 GCATCAAAAAATTGGAAAGGGGG - Intergenic
1016185297 6:141191537-141191559 ACATCATATAAATGGAAAGATGG - Intergenic
1016430396 6:143978158-143978180 AAATCAACAAAGTTGAAAACAGG - Intronic
1017421110 6:154274203-154274225 TCATCATCAAAGTGGAGAGAAGG - Intronic
1017955191 6:159171217-159171239 ACGTCAACACAGTAGAGAGAAGG - Intronic
1018087036 6:160311319-160311341 ACATCAAAAGAGAAGAAAGAGGG - Intergenic
1019090122 6:169523004-169523026 AAATCAACAAAATGAAAAGTTGG + Intronic
1019146777 6:169980754-169980776 AAACCCACAAAATGGAAAGACGG + Intergenic
1020622797 7:10538044-10538066 ACTGCTACAAAGTGGAAAGATGG - Intergenic
1020996737 7:15274992-15275014 AGATCAACAAAATGAAAAGTTGG - Intronic
1021324809 7:19253732-19253754 ACATCAAGAAAGCAGAGAGAAGG - Intergenic
1022025759 7:26446178-26446200 ACCTCAACCAAGTAGAAAAAAGG - Intergenic
1022026889 7:26456418-26456440 ACAGCACCAGAGTGGAAATAGGG + Intergenic
1022618932 7:31962700-31962722 ACATCACCAAAGTAGCATGAAGG + Intronic
1022735672 7:33073606-33073628 CCATGGACAAAGTGGAAAAATGG + Intergenic
1023236692 7:38097922-38097944 ACATCAAAAACAGGGAAAGAGGG - Intergenic
1023257478 7:38326187-38326209 ACCTCAATAAAGCTGAAAGAGGG - Intergenic
1023716471 7:43049237-43049259 AGATCAATAAAGTGAAAAGTTGG + Intergenic
1023797874 7:43808792-43808814 ACAGCAAGAAAGTGGGAGGATGG - Intergenic
1024188150 7:46976077-46976099 AAATAAACAAAGTTGAAAGATGG - Intergenic
1024816074 7:53273321-53273343 ACATTAATAAAGTGGAAGCAAGG + Intergenic
1024831297 7:53461601-53461623 ACATATACAAACTGGAAATAAGG - Intergenic
1024874181 7:54003052-54003074 ACATCATTAAAGCTGAAAGATGG + Intergenic
1024925501 7:54609093-54609115 AAATGAATAAAATGGAAAGAAGG - Intergenic
1025076526 7:55948638-55948660 ACTTCAACAAAGTAGAAAGACGG - Intergenic
1025076527 7:55948680-55948702 ACTTCAACAAAGTAGAAAGATGG - Intergenic
1025193704 7:56916148-56916170 CCCTAAAGAAAGTGGAAAGATGG + Intergenic
1025678239 7:63660793-63660815 CCCTAAAGAAAGTGGAAAGATGG - Intergenic
1026111999 7:67465795-67465817 ACATTAACAAAGAGGGAATACGG - Intergenic
1026929415 7:74215562-74215584 ACGTCTGCTAAGTGGAAAGATGG - Intronic
1028065501 7:86378562-86378584 AGATCAACAAAATTGATAGATGG + Intergenic
1028206909 7:88028083-88028105 ACATCAAAAAAGTAGAAAAAAGG - Intronic
1028334517 7:89635560-89635582 AGATCAACAAAATGAAAAGTGGG - Intergenic
1028633169 7:92958503-92958525 AGATCAACAAAATTGATAGATGG + Intergenic
1028998226 7:97125602-97125624 AAATCAACAAAGAGGAAGAAAGG - Intronic
1029067063 7:97860803-97860825 CCATCAAGAAAGTGAAAAGACGG - Intronic
1029989609 7:104951127-104951149 ACAACAACAAGGTTGCAAGAAGG + Intergenic
1031285692 7:119864558-119864580 ACATTAAAAAAGGGGAAAAAAGG - Intergenic
1031862509 7:126996859-126996881 AAATCAACAATGTTGAAAGTGGG - Intronic
1032504175 7:132423448-132423470 CCATCAGCAAAATGGGAAGAGGG - Intronic
1032765867 7:134992708-134992730 ACAAAAACAAAGTGGTAAAAGGG + Intronic
1033614750 7:143003478-143003500 ACATCAGGAAAATGCAAAGACGG - Intergenic
1035043747 7:155950659-155950681 ACACACACAAAGTGGAGAGAGGG - Intergenic
1035793899 8:2335679-2335701 ACATTACGAAAGTGGAAAAAGGG - Intergenic
1035798903 8:2386029-2386051 ACATTAGGAAAGTGGAAAAAGGG + Intergenic
1036081312 8:5559296-5559318 AAATCAACAAAGTCCAAAGTTGG + Intergenic
1036160627 8:6384871-6384893 AGATCAACAAAATTGATAGATGG + Intergenic
1036565568 8:9935131-9935153 AACTCAACAAAATGGAAAGTTGG + Intergenic
1037169307 8:15872128-15872150 AAATCAACAAAATCGAAAGTTGG + Intergenic
1037199379 8:16232953-16232975 AAATCAAGAAAGTGCAAAAAGGG - Intronic
1037213242 8:16417992-16418014 AGATCAACAAAATTGATAGACGG + Intronic
1038170329 8:25126019-25126041 ACATCAACAAAATGGCAAACTGG + Intergenic
1039156820 8:34569375-34569397 ACTTCAGCAAAGAGGAAATATGG + Intergenic
1041295096 8:56348278-56348300 ACATCAATAAAATGAAAAGTTGG - Intergenic
1042606330 8:70550338-70550360 AAATCCACAAAGTGGTAAGCTGG - Intergenic
1042607388 8:70559035-70559057 ACATCAGCTAAATGGAAATATGG + Intergenic
1042805680 8:72768473-72768495 ACACTAAGAAAGTGAAAAGATGG - Intronic
1042937464 8:74074435-74074457 ACATCAACAAAATTAAAAGCTGG - Intergenic
1042952407 8:74214807-74214829 CCATCAAGAAAGTGAATAGATGG - Intergenic
1042977560 8:74486846-74486868 ACATCAAGAAAGTGCAATGAAGG - Intronic
1043075711 8:75696168-75696190 ATCTCAACAAACTGGAATGATGG + Intergenic
1043626230 8:82262576-82262598 CCATCAGCAAACTAGAAAGAGGG - Intergenic
1044033720 8:87271215-87271237 AGATCAACAAAGTGAAATGGTGG - Intronic
1044144511 8:88694811-88694833 AGATCAACAAAATGAAAAGTTGG - Intergenic
1045184344 8:99821375-99821397 ACATCTCCAAAGTGGAAAGATGG + Exonic
1045593601 8:103627702-103627724 TCATCAAGAAAGTAAAAAGAGGG + Intronic
1045675330 8:104601111-104601133 ACAGAAACAAAGTAGAAAAATGG + Intronic
1048555941 8:135476135-135476157 AAAACAAAAAAGTGGGAAGATGG - Intronic
1049811839 8:144578905-144578927 CCATCAAGAAAGTGAAAAAAGGG + Intronic
1049964754 9:768100-768122 AAATCAATCAAGTGGAAAAAAGG + Intergenic
1050585656 9:7108773-7108795 GCCTCAACAATGTGGAAAGATGG + Intergenic
1051821740 9:21178626-21178648 TCATCAACAAACTTGCAAGAAGG - Intergenic
1054475656 9:65570882-65570904 CCATCAACAAGATGGAAAAATGG + Intergenic
1055763135 9:79631669-79631691 ACATTGACAACGTGGTAAGAGGG + Intronic
1056380637 9:86054141-86054163 ACAACGACAAAGTGAAAAGTAGG + Intronic
1056660812 9:88541687-88541709 ACACAAAGAAAGTAGAAAGAAGG - Intronic
1056716168 9:89031776-89031798 ACATAAACAAAGGAGATAGAAGG - Intronic
1058230887 9:102422921-102422943 TCATCAACAAAATAGAAGGATGG - Intergenic
1058385998 9:104436665-104436687 ATATGAACAAAGGGGAAAAAGGG - Intergenic
1058409610 9:104717120-104717142 AGATCAACAAAATTGATAGACGG + Intergenic
1058633552 9:107014528-107014550 ACATAAACAAAGTGAGAATATGG - Intergenic
1059041154 9:110816851-110816873 ACAAAAACAAATAGGAAAGAGGG + Intergenic
1059194528 9:112358314-112358336 ACAAAAACAAACTGGAAGGAGGG + Intergenic
1059518981 9:114922061-114922083 ACAATAACCCAGTGGAAAGATGG - Intronic
1059529708 9:115024391-115024413 ACAGCTAAAAAGTGAAAAGATGG - Intronic
1062171203 9:135135829-135135851 ACATCCACAAAGTGGATAAACGG + Intergenic
1062176687 9:135167228-135167250 ACATAATCAAAGTGGAAATATGG + Intergenic
1185589672 X:1266348-1266370 ACATCAGCAAAGGTGAAAGATGG - Intergenic
1186139032 X:6551312-6551334 ACTTCTTCAAAATGGAAAGATGG - Intergenic
1186780958 X:12911556-12911578 ACATCAGCAAAGTCCAAATAAGG + Intronic
1186872551 X:13786695-13786717 ACATCCATGAAGTGGAATGAAGG + Intronic
1186989181 X:15049341-15049363 ACACAAACACAGAGGAAAGATGG + Intergenic
1187839647 X:23473903-23473925 AGATCAACAAAATAGATAGACGG - Intergenic
1187924849 X:24240261-24240283 TTATCAAGAAAGTGAAAAGATGG + Intergenic
1187943478 X:24403832-24403854 ACAGAAACAAAGTAGAATGATGG - Intergenic
1187989745 X:24856783-24856805 ACTTCACCAAAGTGGATATAAGG - Intronic
1188046883 X:25435673-25435695 ACAGCTAGAAAGTGGAAAGTGGG - Intergenic
1188925464 X:36037326-36037348 ACAACAACAAAGAGTAAAGTTGG - Intronic
1189370015 X:40420392-40420414 ATATGATCACAGTGGAAAGAAGG - Intergenic
1189592277 X:42526636-42526658 AGATCAACACACTGAAAAGAAGG - Intergenic
1190039940 X:47062882-47062904 TTATAAACAAGGTGGAAAGATGG + Intergenic
1190517488 X:51239337-51239359 AGATCAGCAAAGTGAAAAGTTGG + Intergenic
1190782722 X:53613880-53613902 AAATCAACAAAGGGAAAATAAGG + Intronic
1190820620 X:53968306-53968328 ACACCAACAAATTGGAAACTGGG + Intronic
1190949639 X:55130624-55130646 ACATCATCAAAGAGGCAATAAGG + Intronic
1192149206 X:68701557-68701579 CCATCACCAAGGTGGACAGATGG + Intronic
1193069392 X:77291957-77291979 AGATCAACAAAATTGATAGACGG - Intergenic
1193365958 X:80633675-80633697 ATATCAACAAAATGAAAAGTTGG - Intergenic
1193681170 X:84520050-84520072 AGATGAACAAAGCTGAAAGAAGG - Intergenic
1193747619 X:85300938-85300960 GAATCAACAAATTGCAAAGAAGG + Intronic
1194635409 X:96340703-96340725 AAATATACAAAGTGGAAAGCTGG - Intergenic
1195018994 X:100807459-100807481 ACAAAAACAAAGTGGGAAAAGGG - Intergenic
1195147315 X:102030403-102030425 AAATCAACCAAGTGGAAGAAAGG + Intergenic
1195850165 X:109273996-109274018 ACATAAAAAAAGTGGAAGGAGGG + Intergenic
1196116981 X:112008658-112008680 ACAGCTACAAAGTGGAAAATTGG - Intronic
1196192014 X:112804798-112804820 ACATCAGCACAGTGGAAACTAGG + Intronic
1196550702 X:117020918-117020940 ACATAAACAAAATTGAAAGATGG + Intergenic
1196639584 X:118042937-118042959 AGATCAACAAAATGAAAAGTTGG + Intronic
1197578144 X:128247724-128247746 AAATGAAGAAAGTGAAAAGATGG + Intergenic
1198303653 X:135357083-135357105 CTATCAAGAAAGTGAAAAGATGG - Intronic
1198700143 X:139388040-139388062 ACAGCAACAGAGTTGAAATAGGG - Intergenic
1199337061 X:146630562-146630584 ACATGAACAAATTTGAAGGATGG - Intergenic
1199577575 X:149328026-149328048 ACCTCAATAAAGTTGAAAAAAGG - Intergenic
1200957855 Y:8969945-8969967 ACACCAACTGAGTGGAAAGCTGG + Intergenic