ID: 1005720446

View in Genome Browser
Species Human (GRCh38)
Location 6:28596219-28596241
Sequence TTATTTAACCAGTTCTCTGT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 545
Summary {0: 1, 1: 1, 2: 16, 3: 53, 4: 474}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1005720446_1005720449 0 Left 1005720446 6:28596219-28596241 CCAACAGAGAACTGGTTAAATAA 0: 1
1: 1
2: 16
3: 53
4: 474
Right 1005720449 6:28596242-28596264 TATATGGTAAAGTATGCATTGGG No data
1005720446_1005720448 -1 Left 1005720446 6:28596219-28596241 CCAACAGAGAACTGGTTAAATAA 0: 1
1: 1
2: 16
3: 53
4: 474
Right 1005720448 6:28596241-28596263 ATATATGGTAAAGTATGCATTGG 0: 1
1: 0
2: 0
3: 36
4: 276

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1005720446 Original CRISPR TTATTTAACCAGTTCTCTGT TGG (reversed) Intronic
900821073 1:4889067-4889089 TTTTGTAACCAGCTCTCTGGGGG - Intergenic
903389062 1:22951487-22951509 TTGTTTATCCATTTCTCTGTTGG - Intergenic
904643679 1:31949526-31949548 TTATTTAACAGGTTCCCTATTGG + Intergenic
906534317 1:46543378-46543400 TTATTTAACCAGTATTCACTGGG - Intergenic
906751169 1:48262548-48262570 TAATTTAACCATTCCTCTATTGG - Intergenic
907474540 1:54697029-54697051 TTCTTTATCCATTTGTCTGTTGG + Intronic
907837490 1:58124590-58124612 GTATTTAATCATTTCTCTGATGG - Intronic
907861573 1:58358688-58358710 TATTTTAAACAGTTCTCAGTTGG - Intronic
909316804 1:74231410-74231432 TTCTTTTATCATTTCTCTGTTGG + Intronic
909535208 1:76728221-76728243 TGTTTTAACGAGTTCCCTGTAGG + Intergenic
909992954 1:82246048-82246070 TTTTTAAACCTGTTCTCTGCTGG - Intergenic
909996058 1:82280760-82280782 TCATTTTACTAGTTCACTGTAGG + Intergenic
910054903 1:83021945-83021967 TTATGAAACCAGTTTTCTATGGG + Intergenic
910150092 1:84132223-84132245 TTATTATACCAGAGCTCTGTTGG - Intronic
910323316 1:85975372-85975394 TTCTTTATCCAGTCATCTGTTGG - Intronic
911167628 1:94738318-94738340 TTCTTTATCCAATTCACTGTTGG + Intergenic
912339120 1:108893434-108893456 TTTTTTACCCAGTACTCTATTGG + Intronic
913015025 1:114724210-114724232 TTATTTAAACAATTCTATTTAGG - Intronic
913175498 1:116269261-116269283 TTCTTCAACCAGTCCCCTGTGGG + Intergenic
914046198 1:144094953-144094975 TTATTTAACCAGTCTCCTTTAGG - Intergenic
914131912 1:144865732-144865754 TTATTTAACCAGTCTCCTTTAGG + Intergenic
916570568 1:166022610-166022632 TTCTTTAATCTGTTCTGTGTTGG + Intergenic
917319772 1:173768105-173768127 TTATGTAATCATTTCTCTGGGGG - Intronic
917918174 1:179725553-179725575 TTCTTTAACCACTTCTCCCTTGG - Intergenic
918911152 1:190571999-190572021 TTCTTTATCCATTTATCTGTTGG + Intergenic
919029153 1:192216981-192217003 TCATTTAACCAGTTTTTGGTTGG + Intergenic
919469495 1:197960716-197960738 TTCTTTATCCATTTATCTGTGGG + Intergenic
920331788 1:205213686-205213708 TTATTTAACAAGTCTTCTATTGG + Intergenic
921242754 1:213202921-213202943 TTATTTAATTCGTTCTCTTTAGG + Intronic
922537652 1:226393476-226393498 TTGTTTATCCATTTTTCTGTAGG - Intronic
924210405 1:241760249-241760271 TTATTCAACTAGTCCCCTGTAGG + Intronic
1063205984 10:3830939-3830961 TTTTTTAACCAGTTGTATGAAGG + Intergenic
1063235488 10:4110898-4110920 TTGTTTAACCAGTTATTGGTTGG + Intergenic
1063270290 10:4501425-4501447 TTAGTTAATCATTTCTCTTTAGG - Intergenic
1063730654 10:8693600-8693622 TGGTTTAAACAGTTCTCTGGAGG - Intergenic
1064189227 10:13190893-13190915 TCATTTAAACAATTCCCTGTGGG + Intronic
1065330592 10:24593528-24593550 CTATTTTACCAGTTTTATGTAGG - Intronic
1066403772 10:35099900-35099922 TTACTTGACTAGATCTCTGTGGG + Intergenic
1067331018 10:45319190-45319212 TTCTTTATCCAATTCACTGTTGG + Intergenic
1067660345 10:48232705-48232727 TTAATTAACCTGTGCTCTGCTGG - Intronic
1069148164 10:64921971-64921993 TTCTTTATCCATTTATCTGTTGG - Intergenic
1069764327 10:70842154-70842176 TTATTTAACCATTCTTCTGTGGG + Intronic
1069910560 10:71756392-71756414 TTATTGAAGCAGTCCCCTGTTGG + Intronic
1070032354 10:72689557-72689579 GTATTTAACCATTTCCCTATTGG + Intergenic
1070066059 10:73035577-73035599 TTATTTAACCAGTACTTAATTGG - Intronic
1070208942 10:74294810-74294832 TTTTTTACCCAGTTTTCTATTGG + Intronic
1071774166 10:88766122-88766144 TTATTTATCCAATTATATGTAGG - Intronic
1072956722 10:99893377-99893399 ATATTTAACTAGTCCCCTGTTGG - Intronic
1073226109 10:101920752-101920774 TTGTTTATCCAGTTATCTGTTGG - Intronic
1074011412 10:109485089-109485111 TTCTTTATCCAGTCCACTGTTGG + Intergenic
1074035424 10:109733598-109733620 TTATTCAACCACTTTTTTGTCGG + Intergenic
1074055463 10:109919680-109919702 TTATTTATCCATTTATCAGTTGG - Intronic
1075200997 10:120403905-120403927 TTATTTATCCATCTCTCTCTGGG + Intergenic
1076977005 11:180866-180888 ATATTTACCCAGTTTTATGTGGG - Intronic
1079159290 11:17977420-17977442 GTATTTAACCATTTCTCAGTGGG + Intronic
1079474489 11:20814682-20814704 TTCTTTATCCAGTCCACTGTTGG + Intronic
1079498973 11:21080566-21080588 TTATTTAAACAGATCACTATTGG + Intronic
1079535927 11:21515402-21515424 ATGTTTAACTAATTCTCTGTGGG + Intronic
1079668573 11:23136611-23136633 TGCTTTTCCCAGTTCTCTGTGGG + Intergenic
1080203299 11:29699322-29699344 TTATTGCACTAGTTTTCTGTTGG + Intergenic
1080335222 11:31187724-31187746 TTTTTTAACCAGCTCTGTGAAGG - Intronic
1080455027 11:32410567-32410589 TTTTTTAAACAGTTATCTCTGGG + Intronic
1080613793 11:33928291-33928313 TTATTTAGCCAATCTTCTGTGGG - Intergenic
1080636533 11:34129027-34129049 TTATTTTTCCATTTATCTGTTGG + Intronic
1080874074 11:36260789-36260811 TTATTTAGCCAGTTTCCTATTGG - Intergenic
1080889278 11:36395200-36395222 TTATTTAACCAGTCCCCTATGGG - Intronic
1083901020 11:65643563-65643585 GTGTTTCAGCAGTTCTCTGTGGG - Intronic
1084137393 11:67195874-67195896 TTTTATAACCAGTTCTCAATAGG + Intronic
1084891424 11:72238830-72238852 TTATTTAAACTGTTCTGTGTGGG + Exonic
1085021204 11:73210069-73210091 GTATTTAACCAGTCCTCTGTTGG - Intergenic
1085253440 11:75158883-75158905 TTCCTTTACCTGTTCTCTGTGGG - Intronic
1086389927 11:86353328-86353350 TTGTTTATGCAGTTCTCTTTAGG - Intergenic
1087897087 11:103598363-103598385 TTATTCAACTAGTCCTCTATCGG + Intergenic
1088159039 11:106845852-106845874 GTAATTAACAAGTTATCTGTAGG - Intronic
1089431956 11:118432507-118432529 TACTTTAATCAGTTCTCTATCGG - Intergenic
1090708349 11:129361424-129361446 TTATTTATCTAATTTTCTGTTGG + Intergenic
1091709474 12:2727909-2727931 TTCTTTATCCAGTCCACTGTTGG + Intergenic
1092681295 12:10983972-10983994 TTATTTATGCATTTTTCTGTGGG + Intronic
1092931045 12:13316124-13316146 TTCTTTAACCAATCCCCTGTAGG + Intergenic
1093415915 12:18920544-18920566 TTATTTAACCAGTCACCTGCTGG + Intergenic
1093458812 12:19389750-19389772 TTATTTAACCAGTTCGCTGCAGG - Intergenic
1093937861 12:25020207-25020229 TCATTTAATCAGTTTCCTGTTGG + Intergenic
1094241137 12:28226098-28226120 TGATTTAACCAGTTTTATTTTGG + Intronic
1094331035 12:29293843-29293865 ATATTAAACCAGTTCTATGTCGG + Intronic
1095406570 12:41873035-41873057 TTATTTAACCAGTAGTCATTTGG - Intergenic
1095607173 12:44083055-44083077 TTATTTATCCATTTTTCTATCGG + Intronic
1095709187 12:45269984-45270006 TAATTAAACCAGATCTCTGGAGG - Intronic
1095850861 12:46803608-46803630 TTATTTATCCAGTCCTGTGCAGG + Intronic
1096625505 12:52893107-52893129 TTACTTAACCAGTCCTCTATTGG - Intergenic
1097089861 12:56496442-56496464 TTATTTAACAAATTCCCTATTGG + Intergenic
1097238821 12:57559106-57559128 TTATTTAACCAGGCCTCTGTTGG + Intronic
1097425086 12:59434426-59434448 TTATTTATCCATTCCTCAGTTGG - Intergenic
1097705511 12:62864669-62864691 TGATTTAAGAAGTTCTCAGTGGG - Intronic
1101249918 12:102922617-102922639 TTATTTCATCAGTACTCTGTTGG + Intronic
1101546877 12:105722170-105722192 TTATATTCACAGTTCTCTGTAGG + Intergenic
1101681129 12:106966737-106966759 TAAATTAACCAGTATTCTGTAGG + Intronic
1101928778 12:108995255-108995277 TTGTTTATCCATTTATCTGTTGG - Intronic
1102424948 12:112836581-112836603 TTTTTTAACCATCTCTCTTTAGG - Intronic
1102431213 12:112884500-112884522 TTATTTAGCCAATTCCCTTTGGG + Intronic
1102894873 12:116590883-116590905 TTATATAACCAGTCCCTTGTTGG + Intergenic
1104333220 12:127867002-127867024 TCCTTTAAGCACTTCTCTGTTGG - Intergenic
1105002462 12:132699752-132699774 TTCTTTATCCAGTCCTCTGTTGG + Intronic
1105960219 13:25327834-25327856 TTGTTTAACCCATTTTCTGTTGG + Intronic
1106238802 13:27890365-27890387 TTGTTTATCCACTTATCTGTTGG + Intergenic
1106239705 13:27901370-27901392 ATAATTAACCAGCTCTCTGAAGG + Intergenic
1107134988 13:36934015-36934037 TTGTTTAACCATTCATCTGTAGG + Intergenic
1107575603 13:41717377-41717399 TTACTTAACTAATTCTCTATTGG - Intronic
1108173013 13:47762714-47762736 TTATTTTACCTATTCTCTGTGGG - Intergenic
1108444887 13:50498288-50498310 TTATTTAACCATTCCCCTATTGG + Intronic
1108880217 13:55104428-55104450 TTTTTTAAACACTTCTCTCTAGG - Intergenic
1110094263 13:71496595-71496617 TTATTTAACGAGTACAATGTAGG + Intronic
1110095082 13:71507957-71507979 TTATTTCCTCATTTCTCTGTTGG + Intronic
1111340882 13:86883776-86883798 TTATTTGAAAAGTACTCTGTTGG + Intergenic
1111395044 13:87655548-87655570 TTATTTATCCATTTGCCTGTTGG + Intergenic
1111656337 13:91158431-91158453 TTTTTTAACCAGTACTGTGTAGG + Intergenic
1111883357 13:93986972-93986994 TAATTTATCCAGTTCCATGTTGG + Intronic
1112330406 13:98473182-98473204 TCATTTAACCCATTCTGTGTAGG - Intronic
1113502578 13:110788680-110788702 TGATTTAGTCAGTTCTCTATTGG - Intergenic
1114243488 14:20891355-20891377 TTATTTAAACAGTTCCAAGTAGG + Intergenic
1114250428 14:20955440-20955462 TTATTTAAACAGTTCCAAGTAGG + Exonic
1114858831 14:26490238-26490260 TTATTTATCCATTTACCTGTTGG + Intronic
1115515222 14:34178468-34178490 TTATGAAACCAGTTCTTTGCAGG - Intronic
1116250101 14:42470678-42470700 TTATTTAACTGATTTTCTGTTGG + Intergenic
1116269662 14:42745348-42745370 TTATTTATCCATTCATCTGTTGG - Intergenic
1117181598 14:53197454-53197476 TTATATAACCACTTCTATGATGG + Intergenic
1117876177 14:60251733-60251755 TTATTTAACAAATTCTAAGTTGG + Intronic
1120656374 14:87194988-87195010 TTATTTAACTAGTTCTTCATTGG - Intergenic
1202845269 14_GL000009v2_random:166301-166323 TAATTTCACCAGCTCCCTGTGGG - Intergenic
1202914667 14_GL000194v1_random:156567-156589 TAATTTCACCAGCTCCCTGTGGG - Intergenic
1202877996 14_KI270722v1_random:26148-26170 TAATTTCACCAGCTCCCTGTGGG + Intergenic
1124090345 15:26593699-26593721 TTATTTATCCATTCATCTGTTGG + Intronic
1124562379 15:30786914-30786936 TTACTTAACCAGTTCCCTGTTGG - Intergenic
1125393267 15:39218929-39218951 TTCTTTATCCAGTCATCTGTTGG - Intergenic
1125456552 15:39865958-39865980 TTATTTAACTGGTTCCCTCTTGG - Intronic
1125890112 15:43259342-43259364 ATTTTTAACTAGTTCTCTATGGG - Intronic
1125963828 15:43856169-43856191 TTATTTAACCAGATCTCTCTTGG + Intronic
1126865205 15:52929061-52929083 TTCTTTATCCATTTGTCTGTTGG + Intergenic
1127484983 15:59410604-59410626 TGAGTTACCCATTTCTCTGTTGG - Intronic
1127514939 15:59684398-59684420 TTATTTAGCACTTTCTCTGTTGG + Intronic
1127777306 15:62275203-62275225 TTATTGAACCAGTTCCCTGTTGG + Intergenic
1129484591 15:75857691-75857713 TTATTTAACCAACTCTTTATTGG - Intronic
1129837204 15:78716924-78716946 TGACTTAACCAGTTCCCTGTTGG - Intronic
1130239769 15:82176880-82176902 TTATTTATCCACTCTTCTGTTGG - Intronic
1130264500 15:82387906-82387928 TTATTTAACCAACTCTTTGCTGG - Intergenic
1130267936 15:82425670-82425692 TTACTTAACCAGTTCCCTGTTGG - Intergenic
1130276511 15:82479623-82479645 TTATTTAACCAACTCTTTATTGG + Intergenic
1130436765 15:83907760-83907782 TTCTTTATCCATTTATCTGTAGG + Intronic
1130468877 15:84207020-84207042 TTATTTAACCAACTCTTTATTGG + Intergenic
1130475134 15:84259057-84259079 TTATTTAACCAACTCTTTATTGG - Intergenic
1130476367 15:84321571-84321593 TTATTTAACCAACTCTTTATTGG + Intergenic
1130482549 15:84373110-84373132 TTATTTAACCAACTCTTTATTGG - Intergenic
1130495398 15:84466559-84466581 TTATTTAACCAACTCTTTATTGG - Intergenic
1130504089 15:84521164-84521186 TTACTTAACCAGTTCCCTGTTGG + Intergenic
1130507491 15:84559040-84559062 TTATTTAACCAACTCTTTATTGG + Intergenic
1130547177 15:84865224-84865246 TTCTTCAACCAGCTCTCTGCAGG + Intronic
1130591171 15:85211619-85211641 TTATTTAACCAACTCTTTATTGG + Intergenic
1131446409 15:92501530-92501552 TTCTTTATCCAGTCCACTGTGGG - Intergenic
1131497698 15:92928332-92928354 TTAATTAACACATTCTCTGTAGG + Intronic
1132183945 15:99787218-99787240 TTACTTAACCAGTTCCCATTTGG - Intergenic
1132313660 15:100875776-100875798 TTATGTAATGAGTTCTCCGTTGG + Intergenic
1132434436 15:101785927-101785949 TTACTTAACCAATTCCCTTTTGG + Intergenic
1133257962 16:4529746-4529768 CTATTCAACCAGCTGTCTGTTGG + Intronic
1134018359 16:10904895-10904917 TTATTCAACCCCTTCTTTGTTGG + Intronic
1134032377 16:11002856-11002878 TTCTTTATCTAGTCCTCTGTTGG + Intronic
1134130245 16:11644414-11644436 TTATTCAACCAGTTCCTTCTTGG - Intergenic
1134395313 16:13857088-13857110 ATAGTTAACCAGTTCCCTATTGG - Intergenic
1134793927 16:17017076-17017098 TTCTTTATCCATTCCTCTGTTGG + Intergenic
1134836104 16:17362482-17362504 TTATTTAAACAGTTACCTTTGGG - Intronic
1136400830 16:30017401-30017423 TTCTTTATCCAGTCCACTGTTGG - Intronic
1137395590 16:48114477-48114499 TTATGTAACATGTTCTCTGCAGG + Intronic
1137900375 16:52261294-52261316 TTTCTTAAACAGTTCACTGTAGG - Intergenic
1138635400 16:58334029-58334051 CTAAATAACCAGTGCTCTGTGGG - Intronic
1138890665 16:61140435-61140457 TTCTTTATCCATTCCTCTGTTGG + Intergenic
1139423704 16:66865860-66865882 TTGTTTAACCAGGTCTCTACAGG - Intronic
1142464143 17:119040-119062 ATATTTACCCAGTTTTATGTGGG - Intergenic
1144385833 17:14748365-14748387 TAATTTTTCCATTTCTCTGTAGG - Intergenic
1144888636 17:18480701-18480723 TTATTTCACCTTTTCCCTGTTGG + Intronic
1145143571 17:20463597-20463619 TTATTTCACCTTTTCCCTGTTGG - Intronic
1145931490 17:28689264-28689286 TTATTTAACCAGTTCCCCATTGG + Intronic
1146247356 17:31300534-31300556 TTATTCAACCAGTCCCCTATTGG + Intronic
1148389615 17:47261944-47261966 TTACTTAACCAATTCCCTGTTGG + Intronic
1149147063 17:53506781-53506803 TTCTTTATCCACTTATCTGTTGG + Intergenic
1149434492 17:56621518-56621540 TTATTCTACCATTTTTCTGTAGG + Intergenic
1150201334 17:63361026-63361048 TTGTTTATCCATTTGTCTGTTGG + Intronic
1153155299 18:2142759-2142781 AAATTTAAACAATTCTCTGTGGG - Intergenic
1153386780 18:4507262-4507284 TTCTTTATCTAGTTCTCTATAGG - Intergenic
1153622586 18:6993260-6993282 TAATTTAATCACTTCTCAGTTGG - Intronic
1153869223 18:9301542-9301564 TTATTTAATCAGTCCTCTCCTGG + Intergenic
1153902665 18:9631957-9631979 TTGTTTAATAAGTTCTCTATTGG - Intergenic
1154629710 18:16769911-16769933 GCATTTAACCAGTTCCCTGTAGG - Intergenic
1155039457 18:22052719-22052741 TTATTTACCCATACCTCTGTGGG + Intergenic
1155557429 18:27035449-27035471 TTCTTTATCCATTTATCTGTTGG - Intronic
1155597805 18:27508856-27508878 TTGTTTATCCAGTCATCTGTTGG - Intergenic
1155963079 18:32011557-32011579 TTATTTAACCAGTCACCTATTGG + Intergenic
1156715816 18:40008913-40008935 TTATTTACCCATTCATCTGTTGG - Intergenic
1157643101 18:49237946-49237968 ATATTTAAGTAGGTCTCTGTTGG + Intronic
1157785433 18:50477755-50477777 TTATTGAACCAGTCCCCTATTGG - Intergenic
1158186031 18:54772755-54772777 TTATTTAACAAGTTTTCATTAGG + Intronic
1158240754 18:55375423-55375445 TTATTAAATAAGTTTTCTGTAGG - Intronic
1158361787 18:56682676-56682698 TAGTTCTACCAGTTCTCTGTTGG + Exonic
1158377246 18:56884834-56884856 TTATTGCACCAGTTTTGTGTTGG - Intronic
1158635819 18:59156475-59156497 TTATTTAACCAATCCCCTTTTGG + Intronic
1160484660 18:79278825-79278847 TTCTTTAAACATTTTTCTGTAGG - Intronic
1164604569 19:29588337-29588359 TTCTTTATCCAGTACACTGTTGG + Intergenic
1164611035 19:29631845-29631867 TGACTTAATCAGTGCTCTGTAGG - Intergenic
1164945450 19:32289357-32289379 TTATTTGACCATTTTTCAGTAGG - Intergenic
1202672681 1_KI270710v1_random:6781-6803 TAATTTCACCAGCTCCCTGTGGG - Intergenic
1202685751 1_KI270712v1_random:48368-48390 TTATTTAACCAGTCTCCTTTAGG - Intergenic
925159070 2:1670237-1670259 TTATTTAACAAGTTCTCTTTTGG - Intronic
925361777 2:3285029-3285051 GTATTTAACCACTTCTCCATTGG - Intronic
925420670 2:3708222-3708244 TTCTTTAACCAGGTCGCTGAAGG - Intronic
926070946 2:9890278-9890300 TATTTTTTCCAGTTCTCTGTTGG + Intronic
926881123 2:17544222-17544244 TAATTTAACCCCTCCTCTGTTGG + Intronic
926902430 2:17768105-17768127 TTATTTAACCAGTACACACTAGG - Intronic
927244679 2:20948027-20948049 TTATTGAATTAGTTCTCTATGGG + Intergenic
928047587 2:27952956-27952978 TTCTTTAGCCAGTTCTATATTGG + Intronic
928961198 2:36927966-36927988 TTATTTAACCAGTCTCCTTTAGG - Intronic
929478445 2:42278187-42278209 TTATTAAACCTGTTGTATGTAGG + Intronic
929576125 2:43053757-43053779 TTGTTTATCCATTTTTCTGTTGG + Intergenic
929957737 2:46471619-46471641 TTCTTTAAGCAGATCTCTGCTGG + Intronic
931012781 2:57936730-57936752 ATATTTAATGACTTCTCTGTAGG - Intronic
931347982 2:61463971-61463993 TGATTTAATCAGTTCTTTGAGGG - Intronic
931523282 2:63124007-63124029 TTATTTAACCACTCCTTTTTTGG + Intronic
932211455 2:69934821-69934843 TTATTTAACCAGTTCCCTCCTGG + Intronic
932333054 2:70910658-70910680 ATATTTAGCCATTTCTCTATCGG + Intronic
932374131 2:71220058-71220080 TTACTTAACCAGTTCCCTGATGG + Intronic
932993675 2:76820887-76820909 TCATTTCACCCGTTCTCTGGAGG + Intronic
933936155 2:87205340-87205362 TTCTTTAACCAGGTGTCTGAGGG + Intergenic
933982651 2:87565735-87565757 TTATTTAAACAGAGCTCAGTGGG + Intergenic
934245973 2:90306456-90306478 TTATTTAACCAGTCTCCTTTAGG + Intergenic
934262773 2:91490579-91490601 TTATTTAACCAGTCTCCTTTAGG - Intergenic
935582287 2:104766986-104767008 CCAGTTAACCAGTTCTCAGTTGG + Intergenic
935606453 2:104976225-104976247 TTATTTTATCAGCTCTCTTTAGG + Intergenic
936311189 2:111385058-111385080 TTATTTAAACAGAGCTCAGTGGG - Intergenic
936388168 2:112049045-112049067 TTATATAACAAGTGTTCTGTAGG + Intergenic
936512886 2:113162614-113162636 TTATCTAGCCAGTGCACTGTGGG + Intronic
936728805 2:115356754-115356776 TTCTTTATCCAGTCCACTGTTGG + Intronic
938390386 2:130900613-130900635 TTATTGAAGCAGTTTTCTGGTGG + Intronic
939220595 2:139296833-139296855 TCATTTTGGCAGTTCTCTGTTGG + Intergenic
939563392 2:143758069-143758091 TTATCTAACCATTTCTCTGCTGG - Intronic
940494702 2:154411418-154411440 TTATTTAACCATTCCCCTCTTGG - Intronic
940554288 2:155203763-155203785 TCATTTTAGCAGTTCTTTGTGGG - Intergenic
941252100 2:163178742-163178764 TTGTTTAACCCATCCTCTGTGGG - Intergenic
941259264 2:163275445-163275467 CTATTTAACCAATTCTCTGCAGG + Intergenic
941648922 2:168072018-168072040 TTATTTAACCATTTCCTTCTTGG - Intronic
941652273 2:168104899-168104921 TTATTTAACCTGTCCCTTGTTGG - Intronic
941785623 2:169495601-169495623 TAATCTAACCAGGTGTCTGTGGG - Intronic
943857578 2:192817705-192817727 TTATTTAACCATTTCCTTGGAGG + Intergenic
944817277 2:203390767-203390789 TAATCTAACCAGTGATCTGTTGG + Intronic
944931388 2:204523773-204523795 TTTTTTAACCAGTCCTAAGTTGG - Intergenic
945270716 2:207936820-207936842 TTATCTAACCAGTTCTTTTTTGG - Intronic
945799551 2:214410383-214410405 ACATTTAACCAGTTCTTTGCTGG - Exonic
946250694 2:218409893-218409915 GTATTTAACCAGTTCTTTATTGG - Intergenic
946446864 2:219747502-219747524 TTATTTATACAGTATTCTGTAGG + Intergenic
946453024 2:219797527-219797549 TGATTTAACATGTCCTCTGTTGG + Intergenic
946505133 2:220291511-220291533 TTATCTAATCAGTTCCCTTTTGG + Intergenic
947280958 2:228454213-228454235 TTCTTTATCCAGTCCACTGTTGG + Intergenic
1168872764 20:1145269-1145291 GTATTTATTCAGTTCTGTGTAGG + Intronic
1169005117 20:2200413-2200435 TTATTTACCCAGTTCCCTATTGG + Intergenic
1169282948 20:4282477-4282499 TTAATTAACCAGTTCTCTACAGG + Intergenic
1169472054 20:5894953-5894975 TTATTCATCCAATTCTGTGTCGG + Intergenic
1169955362 20:11097023-11097045 TTCTTTATCCACTTCTCTGTTGG + Intergenic
1170787993 20:19484088-19484110 TTATTTATCCATTTATCTTTTGG - Intronic
1170875993 20:20250782-20250804 TTATTTAAACAGTTTTGTGAGGG - Intronic
1172851410 20:37968975-37968997 ATACTTAACCAGTTGTCTCTAGG - Intergenic
1172856546 20:38008379-38008401 GTATTTAACCAGTCCTTTCTTGG - Intronic
1173237398 20:41259479-41259501 TAATTTAGCCAGTTCCCTGTTGG - Intronic
1173506764 20:43593504-43593526 TTATTTAACCAGTCATCTACTGG - Intronic
1173900588 20:46585041-46585063 TTATTTAACCAATTCCTTATTGG - Intronic
1175097707 20:56554798-56554820 TAATTTAACCAGTTCCCTACTGG + Intergenic
1175416957 20:58807958-58807980 TTATTTAACCAATCCTGTGATGG + Intergenic
1176634020 21:9171212-9171234 TAATTTCACCAGCTCCCTGTGGG - Intergenic
1176639295 21:9283609-9283631 TAATTTCACCAGCTCCCTGTGGG + Intergenic
1176699806 21:10031964-10031986 TTACTTAGCCATTTCTCTATTGG - Intergenic
1176910037 21:14553894-14553916 TTATTTAAAAACTTCTCTTTAGG + Intronic
1177397326 21:20554058-20554080 TTATTTAACAATTTATTTGTGGG - Intergenic
1177581708 21:23031623-23031645 TTCTTTATCCATTTATCTGTAGG + Intergenic
1180372595 22:12056440-12056462 TAATTTCACCAGATCCCTGTGGG + Intergenic
1180389882 22:12219223-12219245 TAATTTCACCAGCTCCCTGTGGG - Intergenic
1180416056 22:12715257-12715279 TAATTTCACCAGCTCCCTGTGGG + Intergenic
1180423340 22:12891098-12891120 TAATTTCACCAGCTCCCTGTGGG + Intergenic
1181490221 22:23256806-23256828 TTTATTCACCTGTTCTCTGTTGG + Intronic
1184862954 22:47186509-47186531 TTATTTATCCATTCATCTGTTGG - Intergenic
950629229 3:14271041-14271063 TTATTTAACCAGTTCCCTGTTGG + Intergenic
950889471 3:16390376-16390398 TTATTAAAGCAGATCTCTGAAGG - Intronic
951029453 3:17864799-17864821 TTATTTAACCATTCCTTTATTGG + Intronic
951108898 3:18777873-18777895 CTATTCAACCACCTCTCTGTAGG + Intergenic
953383285 3:42490192-42490214 TTATTTAACCCCTTCTTTGGGGG - Intronic
953689204 3:45103368-45103390 TTGTTTATCCATTCCTCTGTTGG + Intronic
955359618 3:58261945-58261967 TTGTTTATCCATTTGTCTGTTGG - Intronic
955932931 3:64076070-64076092 TTCTTTATCCATTTATCTGTTGG + Intergenic
956473218 3:69591319-69591341 TTATTTCTCCAATTCTTTGTAGG + Intergenic
959123358 3:102259715-102259737 TTATTTAACCAGTTCTGTATTGG + Intronic
959334209 3:105043625-105043647 TTTTTTAATCATGTCTCTGTGGG + Intergenic
959342800 3:105151852-105151874 TTATCTAACCAGTTGTGTGGAGG - Intergenic
959627975 3:108474011-108474033 TTGTTCAACCACTTCACTGTGGG + Intronic
960668747 3:120136369-120136391 TTCTTTATCCATTCCTCTGTTGG - Intergenic
961396739 3:126598678-126598700 TTCTTTATCCATTTATCTGTTGG - Intronic
961624335 3:128249817-128249839 TTATTTATCCATTCTTCTGTTGG + Intronic
961767412 3:129222152-129222174 TTATTTACCCATTTTTCTATTGG - Intergenic
963567999 3:146954792-146954814 TCATTTATCCAGTCTTCTGTTGG - Intergenic
963716413 3:148809148-148809170 TTACTTAACCATTTTTTTGTTGG - Intronic
966587777 3:181646505-181646527 TTATTTAGCCAGTCCCCTGTTGG - Intergenic
967970738 3:194997218-194997240 TTATTTAACCAATGCCCTATTGG - Intergenic
968263748 3:197346064-197346086 TTACTTAACCACTTCTTTATTGG + Intergenic
1202747600 3_GL000221v1_random:121418-121440 TAATTTCACCAGCTCCCTGTGGG - Intergenic
971303268 4:25459268-25459290 TTCTTTATCCAGTTATCTGTTGG + Intergenic
972098976 4:35388210-35388232 TTCTTTATCCAATCCTCTGTTGG - Intergenic
972297245 4:37751778-37751800 GTATTTAACCAGTCCTCTACTGG + Intergenic
972364201 4:38358603-38358625 TTATTTATCCATTTCTCTTCTGG - Intergenic
972393248 4:38632982-38633004 TAATTGAACCATTTCTTTGTTGG + Intergenic
972432066 4:38992603-38992625 TGATTTAACATGTTCTCTCTTGG - Intronic
972542262 4:40049483-40049505 GCATTTAACCAGTTCCCTGTAGG + Intergenic
972715958 4:41646256-41646278 TTCTTGAACAATTTCTCTGTAGG - Exonic
973192005 4:47396022-47396044 TTAGTTAACCACTCTTCTGTCGG + Intronic
973694211 4:53474138-53474160 TTATTTAACCAGTTCCTAATTGG + Intronic
974220756 4:58968110-58968132 TCATTGAACCAGTTTTCTTTTGG + Intergenic
974311486 4:60216164-60216186 TTATTGCACCAGGTGTCTGTGGG - Intergenic
975958769 4:79875251-79875273 ATATTTATCCAGGTCTGTGTAGG + Intergenic
976378898 4:84377105-84377127 GTCTTTAACCATGTCTCTGTTGG + Intergenic
976873597 4:89826838-89826860 TTACTTAACTACTTCTCTGTTGG + Intronic
976980610 4:91221910-91221932 TTATTTAACAATTTCCCTTTCGG - Intronic
977092745 4:92700015-92700037 TTTTTCAACAAGTTTTCTGTTGG + Intronic
977307279 4:95341292-95341314 TTATTTAACCATTCCTCAGTTGG - Intronic
977375065 4:96192092-96192114 TTATTTCACCAATTCTCTCTTGG + Intergenic
977825456 4:101526024-101526046 TTATTTGCAAAGTTCTCTGTTGG - Intronic
978352061 4:107830261-107830283 TTCTTTATCCAGTCCACTGTTGG + Intronic
978383330 4:108153777-108153799 TTATTTAACCAGTATTTTATTGG - Intronic
978414151 4:108457987-108458009 TTATTTAACTAGTCCGCTATTGG - Intergenic
978461748 4:108962550-108962572 CTATGTAACCAGTTCTTTGATGG + Intronic
978988816 4:115051645-115051667 TTCTTTAACCATTCATCTGTTGG + Intronic
978996778 4:115166538-115166560 TCTTTTAACCATTTATCTGTTGG + Intergenic
979253172 4:118586335-118586357 TTATTTCACAAGTTCAGTGTCGG - Intergenic
979463589 4:121010600-121010622 TCTTTTAACTAGTCCTCTGTTGG + Intergenic
979757349 4:124358340-124358362 TTCTTTACCCATTTATCTGTTGG - Intergenic
980655919 4:135786062-135786084 TTATTTATCCATTCATCTGTTGG - Intergenic
981150285 4:141372324-141372346 TTGTTTATCCAGTCCACTGTTGG + Intergenic
981230402 4:142347381-142347403 TTATTTGGCCAGTGCTCTGAGGG + Intronic
983458160 4:167991213-167991235 TTATTTTACAACTTTTCTGTGGG - Intergenic
984088145 4:175337338-175337360 TTATTTAACCAATTTTATATTGG + Intergenic
984623084 4:181975475-181975497 TTGTTTATCCAGTTAACTGTTGG + Intergenic
984747193 4:183232953-183232975 TTATTTATCCAGTCATCAGTTGG + Intronic
984947370 4:184980230-184980252 TTTCTTGACCATTTCTCTGTTGG - Intergenic
985326394 4:188775890-188775912 TTATTGTACCAGTTTTGTGTTGG + Intergenic
1202754187 4_GL000008v2_random:42001-42023 TAATTTCACCAGCTCCCTGTGGG + Intergenic
985814994 5:2120895-2120917 TTCTTTAACCACTCTTCTGTTGG + Intergenic
985860897 5:2469991-2470013 TTTTAAAACCTGTTCTCTGTGGG + Intergenic
986182714 5:5408500-5408522 TTATTTAAAGAGCTTTCTGTGGG - Intergenic
986412751 5:7497812-7497834 TTATTTAACCAGTTACCAGTCGG + Intronic
986504376 5:8433459-8433481 TTATTAAACAAGGTCACTGTTGG + Intergenic
986557969 5:9030439-9030461 TATTTTAATGAGTTCTCTGTGGG - Intergenic
986772008 5:10982757-10982779 TTCTTTAACCATTCATCTGTTGG - Intronic
987123168 5:14786923-14786945 TTATTTAACCTTTCCTATGTTGG - Intronic
987760359 5:22153805-22153827 TTCTTTATCCAGTCATCTGTTGG - Intronic
987810834 5:22833658-22833680 TTATTTGAAAAGCTCTCTGTCGG + Intronic
989013481 5:36901327-36901349 TTCTTTATCCAGTCCACTGTTGG + Intronic
989645364 5:43626054-43626076 ATATTTAAACAATACTCTGTAGG + Intronic
989824882 5:45840996-45841018 TTCTTTATCCAGTCCACTGTTGG + Intergenic
989976351 5:50591955-50591977 TTGTTAAACCAGTTCTCTGATGG - Intergenic
990566419 5:57033966-57033988 TTATTTAACTACTTCTCTATTGG - Intergenic
990688086 5:58330516-58330538 TTATGTAAACATTTCTTTGTTGG - Intergenic
990832334 5:59972973-59972995 TTGTATAACCATTCCTCTGTTGG - Intronic
990998330 5:61756138-61756160 TGAGTTAATCAGTTCTCTGTTGG - Intergenic
991247958 5:64527661-64527683 TTATTTAATTAATCCTCTGTTGG - Intronic
991895104 5:71387248-71387270 TTCTTTATCCAGTCATCTGTTGG - Intergenic
992300752 5:75377476-75377498 TTATTTAATCAGTTCTGCATTGG - Intronic
992587725 5:78258801-78258823 TTCTTTATCCATTTGTCTGTTGG - Intronic
993328767 5:86570711-86570733 TTCTTTAACCAGGTGTCTGAGGG - Intergenic
993706032 5:91171966-91171988 ATGTTTAGCCAGTTCTCTGCAGG + Intergenic
993727437 5:91383924-91383946 TTTTTAAACCAGTACTTTGTAGG + Intergenic
993780362 5:92059380-92059402 TTATTTATCCATTTATCTGTTGG + Intergenic
993820252 5:92605620-92605642 TTATTTAAACAGTTTGCTATAGG + Intergenic
994412669 5:99428216-99428238 TTATCTAATCAGTTCTATGAAGG - Intergenic
994481172 5:100337507-100337529 TTATCTAATCAGTTCTATGAAGG + Intergenic
995296258 5:110526810-110526832 TTATTTAACCAATTTTCTATTGG - Intronic
995376262 5:111477493-111477515 TTTTTTAAGCAGTTCCCTCTTGG + Intronic
995822209 5:116248640-116248662 TTATTCATACAGGTCTCTGTTGG + Intronic
995896037 5:117011928-117011950 ATAATAAACCATTTCTCTGTTGG + Intergenic
996020410 5:118585233-118585255 TTATATATCCAGGTATCTGTTGG + Intergenic
996998863 5:129733913-129733935 TGCTTTATCCAGTTATCTGTTGG - Intronic
997203770 5:132029035-132029057 TTGTTTATCCATTTTTCTGTTGG - Intergenic
997315271 5:132928626-132928648 TTATTTAATCAGTACTGTGTTGG - Intronic
998479729 5:142452768-142452790 TTATTTTATCTGTTCTTTGTTGG + Intergenic
999116425 5:149168150-149168172 CTAGTTCACCAGTTCTCTATTGG - Intronic
999463864 5:151782281-151782303 TTATTTAACCAACTCTCACTAGG - Intronic
999652103 5:153777750-153777772 TTTTTTAGCATGTTCTCTGTGGG - Intronic
999726701 5:154444537-154444559 TTACTTAACCACTTCCCTTTTGG + Intergenic
1000662680 5:163955458-163955480 TTAATTAACAAATTATCTGTAGG + Intergenic
1000724216 5:164748769-164748791 TTTTTTAACCATATCTTTGTGGG - Intergenic
1000756985 5:165173735-165173757 TTATTTAAGAAAGTCTCTGTCGG - Intergenic
1000927797 5:167214999-167215021 TTATTTATATAGTTCTCTCTAGG + Intergenic
1001047055 5:168382109-168382131 TTATTTAACCAGACCTCGATGGG - Intronic
1001646803 5:173288141-173288163 TTTTTAAACCAGTCCCCTGTAGG - Intergenic
1001777051 5:174336963-174336985 TTATCTAACCAGTTCTTTTCAGG + Intergenic
1003242982 6:4360779-4360801 TTAAGTAACCAAGTCTCTGTTGG + Intergenic
1003595609 6:7471594-7471616 TTGTTTATCCATTTATCTGTTGG + Intergenic
1004065754 6:12242225-12242247 TTTTACAACCAGTTCTCTCTAGG + Intergenic
1005095184 6:22106724-22106746 TTGTATAATCAGATCTCTGTAGG - Intergenic
1005215347 6:23521034-23521056 TTATTTAATAAGTTTTCAGTTGG - Intergenic
1005468445 6:26138617-26138639 TTATGTAACCTGTCCACTGTTGG + Exonic
1005514621 6:26541778-26541800 TCATTTAACCAGATTGCTGTAGG - Intronic
1005672383 6:28120241-28120263 TTTTTTAAACAGTCCACTGTGGG + Intergenic
1005720446 6:28596219-28596241 TTATTTAACCAGTTCTCTGTTGG - Intronic
1006198796 6:32267040-32267062 TTATTTAAACACTCCCCTGTAGG - Intergenic
1006872698 6:37266800-37266822 TTATTTAACTACTTTCCTGTTGG + Intronic
1008222381 6:48871351-48871373 TTATTTAGCCTGTTTTCTATCGG + Intergenic
1009203083 6:60769558-60769580 TTATTTAATTACTTTTCTGTAGG - Intergenic
1009955010 6:70442904-70442926 TTATTCAACCAGTCCCCTATTGG + Intronic
1010886326 6:81246758-81246780 TTCTTTATCCAGTCATCTGTTGG - Intergenic
1011690830 6:89866850-89866872 TTCTTTCAGCAATTCTCTGTTGG - Exonic
1011709632 6:90039165-90039187 TTATATAACCAATTCTCTATTGG + Intronic
1011867736 6:91851502-91851524 TTAAATAATCATTTCTCTGTGGG - Intergenic
1012280621 6:97323624-97323646 TTTTATAACCAGTTCTCTAGGGG - Intergenic
1012291814 6:97465309-97465331 TTATTTTATTATTTCTCTGTGGG + Intergenic
1012409884 6:98945252-98945274 TTATTTAGCCAGTCCCCTGTTGG - Intronic
1012770665 6:103429476-103429498 TTCTTTAACCAGTCCACTGTTGG - Intergenic
1013723592 6:113063577-113063599 TTATTTATCCATTCATCTGTTGG + Intergenic
1013749905 6:113392682-113392704 TTATTCAGACAATTCTCTGTTGG + Intergenic
1015074256 6:129135370-129135392 TTATTGAACCCTTCCTCTGTGGG + Intronic
1015470984 6:133606174-133606196 TAAGTTAACCAGTCCTCTATTGG - Intergenic
1016278982 6:142391068-142391090 TTATTTAACCAGTATCCTATTGG + Intronic
1016353689 6:143195017-143195039 TTATTTAACCCCTTGTTTGTGGG + Intronic
1016787934 6:148033784-148033806 TTGTTTAACCATTCATCTGTTGG - Intergenic
1018158066 6:161008239-161008261 TAATTTAACCAGTCTTTTGTCGG + Intronic
1018205176 6:161430431-161430453 TTGCTTAACCTGTTCTCTCTTGG + Intronic
1018263641 6:161996141-161996163 TTCTTTATCCATTTATCTGTTGG - Intronic
1018925530 6:168204067-168204089 TTCTTTATCCATTTATCTGTTGG - Intergenic
1020381614 7:7553797-7553819 TTATATAAACAGTTTTCTGTTGG - Intergenic
1020713203 7:11635482-11635504 TTATTTAACAAATTATCTTTGGG - Intronic
1021466662 7:20951860-20951882 TAATTTAACCAGTCCACTGTTGG - Intergenic
1022007608 7:26280597-26280619 TTATTTAAACATTTCTGTATTGG + Intergenic
1022684657 7:32585076-32585098 TTTTTTAAACAGTTTTCTATTGG + Exonic
1022767847 7:33435158-33435180 TTAGTTGAACACTTCTCTGTAGG + Intronic
1023013121 7:35940830-35940852 GTATTTACCCAGTTCTCTACAGG - Intergenic
1023258826 7:38338062-38338084 TTATGTAATAAGTTCTCTTTTGG + Intergenic
1023260283 7:38351372-38351394 TTATTTTATAAGTTCTCTTTTGG + Intergenic
1023261776 7:38365334-38365356 TTATTTCATAAGTTCTCTTTTGG + Intergenic
1024078013 7:45833004-45833026 GTATTTACCCAGTTCTCTGCAGG + Intergenic
1025126403 7:56348416-56348438 GTATTTACCCAGTTCTCTACAGG - Intergenic
1026325867 7:69309864-69309886 TTATTTCACCAGTCCTCTCTTGG - Intergenic
1027585572 7:80054472-80054494 TTATTTATCCATTCGTCTGTTGG + Intergenic
1027627541 7:80564223-80564245 TTATCAAACCTGATCTCTGTGGG - Intronic
1027918816 7:84363246-84363268 TTAATGAATCAGTTCTTTGTTGG - Intronic
1028929093 7:96392923-96392945 TTCTTTATCCATTTGTCTGTTGG + Intergenic
1033357942 7:140615887-140615909 TTGTTTATCCAGTTATTTGTTGG - Intronic
1033415705 7:141159558-141159580 TTGTTTATCCATTTGTCTGTCGG - Intronic
1033836402 7:145317507-145317529 TTATTTAACCAGTCTCCTATTGG + Intergenic
1034515477 7:151574193-151574215 TTATTTAACTAGTCCTATTTGGG - Intronic
1034548382 7:151804226-151804248 TAGTTTAACCAGTCCCCTGTAGG + Intronic
1036724277 8:11205633-11205655 TTATTTAACTAGTTCCCCTTTGG - Intergenic
1036929835 8:12944936-12944958 TTATATAACACATTCTCTGTTGG + Intergenic
1037844124 8:22267642-22267664 TGTGTTGACCAGTTCTCTGTGGG + Intergenic
1037849758 8:22317547-22317569 TTATTTAACCAATCCTCTCTTGG + Intronic
1037954849 8:23047962-23047984 TTCTTTATCCATTTATCTGTTGG - Intronic
1038232689 8:25718194-25718216 TGGTTTAACCAGTTGTCTCTAGG + Intergenic
1038975890 8:32695564-32695586 TTAGTTATACTGTTCTCTGTTGG + Intronic
1039017393 8:33166909-33166931 TTATTTAGCCAGTTCTCTATTGG - Intergenic
1039617406 8:38967172-38967194 TTCTTTATCGAGTCCTCTGTTGG + Intronic
1039670555 8:39592449-39592471 TTATTTATCCAGTGAACTGTTGG - Intronic
1040781406 8:51114215-51114237 TTATTTAACTAGTTGTTTGGGGG + Intergenic
1042037419 8:64550659-64550681 TTATTCAACCAGTCCTCTCTTGG + Intergenic
1043285103 8:78517816-78517838 TTATTGCAACTGTTCTCTGTTGG - Intronic
1043626033 8:82259777-82259799 TTATTTAACCTTTTCCATGTAGG + Intergenic
1043764967 8:84119755-84119777 TTTTTGAACCAGCTATCTGTGGG - Intergenic
1043827520 8:84947643-84947665 TTTCTTAAACAGTTCTCTGGAGG - Intergenic
1044421746 8:92004443-92004465 TTATTCAACAATTACTCTGTAGG + Intronic
1044983584 8:97738988-97739010 TTACTTAACCATTTCCCTATTGG + Intergenic
1045344063 8:101278994-101279016 TTATTTATTCAGTCCACTGTTGG - Intergenic
1046451912 8:114403984-114404006 TTTTTTTACCAGTTCTAAGTGGG - Intergenic
1046847669 8:118936183-118936205 TTATTTCTTCATTTCTCTGTGGG - Intronic
1047248646 8:123165607-123165629 TTCTTGAAACAGTTCTCTGCAGG + Intergenic
1047322876 8:123804770-123804792 TTAGTTAACCAGTCCCCTGTTGG + Intronic
1047339315 8:123965232-123965254 TAACTTAATCAGTTCTCTATTGG + Intronic
1048052729 8:130834230-130834252 TCCTTTACCCAGTTTTCTGTTGG - Intronic
1050278235 9:4022673-4022695 TTGTTTATCCACTTCCCTGTGGG - Intronic
1050427534 9:5526896-5526918 TTATTTAACCACTTCCCTGTTGG + Intronic
1052876306 9:33568899-33568921 TTATATGACCATTTCTCTTTTGG + Intronic
1053499708 9:38575448-38575470 TTATATGACCATTTCTCTTTTGG - Intronic
1053636955 9:40018433-40018455 TTACTTAGCCATTTCTCTATTGG - Intergenic
1053769074 9:41446469-41446491 TTACTTAGCCATTTCTCTATTGG + Intergenic
1054317784 9:63615226-63615248 TTACTTAGCCATTTCTCTATTGG - Intergenic
1054547745 9:66357970-66357992 TTACTTAGCCATTTCTCTATTGG + Intergenic
1055081260 9:72269559-72269581 GTATTTAACCAGTGCCTTGTTGG - Intergenic
1055515253 9:77027091-77027113 TTATTTAAACATTTCCCTATGGG - Intergenic
1055912086 9:81364375-81364397 ATACTTAACCAGTTGTCTCTAGG + Intergenic
1056262928 9:84866821-84866843 TTATTTATCCATTCATCTGTTGG - Intronic
1056846514 9:90042548-90042570 TTATTTAAGCATTTTCCTGTTGG - Intergenic
1058030666 9:100193961-100193983 TTGTTTAACCATTTGCCTGTTGG + Intronic
1058793868 9:108478287-108478309 TTATTTTACCAGGTTCCTGTAGG + Intergenic
1058887592 9:109333377-109333399 TTGTTTATCCATTTATCTGTTGG - Intergenic
1060381127 9:123173708-123173730 GTATTTAACAGGGTCTCTGTGGG + Exonic
1060686664 9:125620614-125620636 TTATGTAACTAATTCTCTGTCGG - Intronic
1202784819 9_KI270719v1_random:2023-2045 TTACTTAGCCATTTCTCTATTGG - Intergenic
1203756865 Un_GL000218v1:138848-138870 TAATTTCACCAGCTCCCTGTGGG - Intergenic
1203716236 Un_KI270742v1:151509-151531 TAATTTCACCAGCTCCCTGTGGG - Intergenic
1203534979 Un_KI270743v1:26726-26748 TAATTTCACCAGCTCCCTGTGGG + Intergenic
1203548355 Un_KI270743v1:147063-147085 TTATATGACCATTTCTCTTTAGG - Intergenic
1185927512 X:4163689-4163711 TTCTTTATCCAGTCCACTGTTGG - Intergenic
1185979762 X:4764686-4764708 TTATTTAACCATTTTTGTATGGG + Intergenic
1186774065 X:12846592-12846614 TTACTTAACCATTTCTCTAACGG - Intergenic
1186935447 X:14445754-14445776 TAATTTATCCAGTCCTCTCTTGG + Intergenic
1187165985 X:16804308-16804330 TTATTTAACCAGTTCCCTATTGG + Intronic
1187174178 X:16881329-16881351 TTATTTACCCATTTGTCAGTTGG - Intergenic
1187282663 X:17870941-17870963 TTATTTAACCATTAACCTGTTGG + Intergenic
1187299753 X:18036752-18036774 TTATTTAACTGGTCCTCAGTTGG + Intergenic
1187430209 X:19216154-19216176 TGATTTGACCAGTCATCTGTGGG + Intergenic
1187544926 X:20240697-20240719 TTATTTAACCAGTCCCTTGTTGG - Intronic
1187654905 X:21460917-21460939 TTCTTTATCCATTTATCTGTTGG + Intronic
1188265549 X:28068799-28068821 TTATTTATCCATTTATCTGTTGG + Intergenic
1188302069 X:28516660-28516682 TTATTTAACAAATTCTCTACTGG + Intergenic
1188611832 X:32109401-32109423 TTATTGATACAGGTCTCTGTTGG - Intronic
1188885161 X:35540903-35540925 TTAATAATTCAGTTCTCTGTAGG - Intergenic
1189024592 X:37379495-37379517 TTATTTAATCAGTCCTCTATTGG - Intronic
1189137550 X:38564371-38564393 TTGTTTATCCATTTGTCTGTTGG + Intronic
1190120579 X:47656109-47656131 TTATTGAAGCAGATCTGTGTTGG - Intronic
1190616748 X:52241938-52241960 TTATTTAAACACTCCCCTGTTGG + Intergenic
1191680841 X:63838563-63838585 TCATTTATCCATTTATCTGTGGG - Intergenic
1193254808 X:79335227-79335249 TTATTTATCCAATTCTCTGTTGG + Intergenic
1193583555 X:83293952-83293974 TTATTTTCTCTGTTCTCTGTGGG - Intergenic
1194073529 X:89359026-89359048 TTATTTAACCATATGTGTGTGGG + Intergenic
1194562953 X:95446070-95446092 TTCTTTATCCATTTATCTGTAGG + Intergenic
1194659958 X:96620082-96620104 TTCTTTATCCAGTCTTCTGTTGG - Intergenic
1194936600 X:99957457-99957479 TTCTTTATCCATTTGTCTGTTGG + Intergenic
1194946204 X:100070934-100070956 TTTTTTCAGCATTTCTCTGTTGG - Intergenic
1195277508 X:103296711-103296733 ACAGTTATCCAGTTCTCTGTTGG + Intergenic
1195355268 X:104033560-104033582 TTCTTTAACAAGGTTTCTGTTGG + Intergenic
1195929192 X:110056409-110056431 TTATGTATCCATTTGTCTGTTGG + Intronic
1196318201 X:114254838-114254860 TTATTTAACAAGCTCCCTGAGGG - Intergenic
1196528328 X:116752920-116752942 TTATTTATCCAGTCAACTGTTGG + Intergenic
1197453310 X:126644886-126644908 TTCTTTATCCAGTTCATTGTTGG - Intergenic
1197496637 X:127191629-127191651 TAATTTAACCTATTCTATGTAGG + Intergenic
1197507589 X:127326910-127326932 TTATTGACCAAGTTCACTGTGGG - Intergenic
1197577075 X:128227657-128227679 TTCTTTATCCATTTCTCTATTGG - Intergenic
1197786279 X:130200349-130200371 TTATTTATCCCTTTATCTGTGGG + Intergenic
1197858245 X:130941758-130941780 TTCTTTATCCATTTATCTGTTGG + Intergenic
1198536967 X:137595890-137595912 TTATTTTACCAGTGCTCCATCGG + Intergenic
1199083519 X:143604307-143604329 TTTTTTAACCAGTTTTATTTTGG + Intergenic
1199099145 X:143778725-143778747 TTCTTTATCCATTTATCTGTTGG - Intergenic
1199665974 X:150096776-150096798 TTATTTAGCAAGTACTCTGGGGG - Intergenic
1199867438 X:151864954-151864976 TTCTTTATCCATTTATCTGTTGG + Intergenic
1200496725 Y:3894674-3894696 ATATTTAACCTTTTATCTGTAGG + Intergenic
1200728911 Y:6710603-6710625 TTATTTAACCATATATGTGTGGG + Intergenic
1200925730 Y:8652883-8652905 TTATTTAACTAGGTGTCTGAAGG + Intergenic
1202365817 Y:24163432-24163454 TTACTTAACCAGTTCCCTGTTGG - Intergenic
1202504965 Y:25506690-25506712 TTACTTAACCAGTTCCCTGTTGG + Intergenic