ID: 1005721674

View in Genome Browser
Species Human (GRCh38)
Location 6:28608400-28608422
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 83
Summary {0: 9, 1: 12, 2: 9, 3: 12, 4: 41}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1005721674_1005721680 -8 Left 1005721674 6:28608400-28608422 CCGGACTTTGGGTACCCTACGGG 0: 9
1: 12
2: 9
3: 12
4: 41
Right 1005721680 6:28608415-28608437 CCTACGGGTGGTGTTGAGGCTGG 0: 16
1: 26
2: 15
3: 10
4: 147

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1005721674 Original CRISPR CCCGTAGGGTACCCAAAGTC CGG (reversed) Intronic
902956405 1:19926892-19926914 CCTGTAGAGTACCTGAAGTCCGG + Intergenic
902956991 1:19932184-19932206 CCCGTAGGGTACCCAAAGTCCGG + Intergenic
904242421 1:29156755-29156777 CCCGTAGGGTACCCAAAGTCTGG + Intronic
913274319 1:117122362-117122384 CCCGAAAAATACCCAAAGTCGGG - Intronic
915409822 1:155691853-155691875 CCCGTAGGGTATCCGAAGTCCGG + Intronic
915410626 1:155699002-155699024 TCCGTAGGGTACCTGAAGTCCGG + Intronic
915779830 1:158535100-158535122 CCCGTAGGGTATCCGAAGTTTGG - Intergenic
916218507 1:162419894-162419916 CCCAGAGGGTACCCGGAGTCCGG - Intergenic
917638706 1:176961395-176961417 CCTGTAGGGGAAGCAAAGTCAGG + Intronic
921228517 1:213045139-213045161 CCTGTAGGGTACTCGAAGTCCGG + Intergenic
924775104 1:247111133-247111155 CCCGGCGGGTACCCCGAGTCCGG - Exonic
1066654472 10:37685671-37685693 CCTGTAGGGTACCCAAAGTCCGG - Intergenic
1076674217 10:132139977-132139999 CCTGGAGGGTCCCCAAAGGCAGG + Intronic
1083572459 11:63768077-63768099 CCCGAAGGGGACCCAGGGTCTGG + Intronic
1085212231 11:74791525-74791547 CCTCTGGGGTGCCCAAAGTCTGG + Intronic
1092871560 12:12810313-12810335 CCCGTAGGGTACCCAAAGTCCGG + Intronic
1105039341 12:132949524-132949546 CCCGTAGGGTACCCAAAGTCCGG - Intronic
1107149003 13:37090732-37090754 CCCATAGGGTATCCAAAGTCTGG - Intergenic
1111213473 13:85111082-85111104 CCCCTACTTTACCCAAAGTCGGG + Intergenic
1116683794 14:48011733-48011755 CCCGGCGGGTACCCCGAGTCCGG - Intergenic
1118522061 14:66596507-66596529 CCTCTTTGGTACCCAAAGTCTGG + Intronic
1119420803 14:74506667-74506689 CCTGTGGGCTACCCAAGGTCTGG - Intronic
1120036801 14:79706978-79707000 CCCGTAGGGTACCCGAAGTCCGG - Intronic
1131179057 15:90227985-90228007 CCCGTTGCGTAGCCAGAGTCGGG - Exonic
1134001409 16:10785897-10785919 CCTGTAGGGTACCCAAAGTCCGG - Intronic
1134001783 16:10788520-10788542 CCCGTAAGGTACCCGAAGTCCGG + Intronic
1142479746 17:211747-211769 CCCCAAGGGTAGCCAAAGGCTGG - Intergenic
1143621440 17:8082802-8082824 CCTGTAGGGTACCCAAAGTCCGG - Intronic
1144359180 17:14475533-14475555 CCCCCAGGGTCCCCATAGTCTGG + Intergenic
1161898548 19:7100454-7100476 CCCGTAGGGTACTCTAAGTCCGG + Intergenic
1164093941 19:21987974-21987996 CCTGTAGGGTACAGAAAGTCCGG - Intronic
1164291833 19:23876602-23876624 CCTGTGGGGTACCTGAAGTCCGG + Intergenic
1165258609 19:34595190-34595212 CCCGTAGGGTACCCGAAGTCTGG + Exonic
1165477150 19:36037547-36037569 CCAGTAGTGTGCCCACAGTCAGG - Intronic
1165556436 19:36636567-36636589 CCTGTAGGGTACCTGAAGTCCGG + Intergenic
1166424734 19:42667580-42667602 CCCGTAGGGTACCTGAAGTCTGG + Intronic
1166897208 19:46031421-46031443 CCCGTAGGGTACCCAAAGTCCGG - Intergenic
1168698427 19:58419782-58419804 CACGTAGGGTAACCAAAGTATGG + Intergenic
925332461 2:3069409-3069431 CCCGTGGGGCACCCAAGGACGGG - Intergenic
932439274 2:71721562-71721584 CCCTCAGGGAACCCAAGGTCAGG + Intergenic
933066809 2:77808138-77808160 CCCAGTGGGTACCCCAAGTCCGG - Intergenic
933835959 2:86245709-86245731 CCCATAGGGTAGCTGAAGTCCGG - Intronic
935818227 2:106867829-106867851 CCCGTGGAGGACTCAAAGTCAGG + Intronic
1170874473 20:20237294-20237316 CTCGTAAGGTACCCTGAGTCTGG - Intronic
1171119719 20:22557925-22557947 CCTGGGGGGTCCCCAAAGTCGGG + Intergenic
1172286436 20:33743897-33743919 CCCTTAGGGGACTCACAGTCTGG + Intronic
1174332559 20:49831683-49831705 CCCGTGGGGCCCCCAAACTCAGG + Intronic
1184548333 22:45189239-45189261 CCCGTAGGGTACCCGAAGTCTGG - Intergenic
955419793 3:58724789-58724811 CCCGTAGGGTACCCGAAGTCCGG - Intronic
959012108 3:101089612-101089634 CCCGTAGGGTATTTAAAGTTTGG - Intergenic
961712024 3:128835127-128835149 CCCACAGGGTACCCGAGGTCGGG - Intergenic
967440752 3:189505623-189505645 CCTGAAGGGTTCCCAAAATCAGG - Intergenic
969647648 4:8441753-8441775 CCCGTAGGGTACTCAAAGTCCGG + Intronic
976306544 4:83565694-83565716 CCCGGTGGGTACCCCGAGTCCGG + Intronic
976333391 4:83857484-83857506 CACCTAGGGTATCCAAAGTAGGG - Intergenic
981354962 4:143778284-143778306 CCCGTAGGGTACCCAAAGTCTGG - Intergenic
992586453 5:78245047-78245069 CCCATAGGGTACCCAAAGTCCGG + Intronic
1004138218 6:12989600-12989622 CCTGTAGGATATCCAAAGTCCGG + Intronic
1005575777 6:27188024-27188046 CCCTTAGGGTACCTAAAGTCCGG - Intergenic
1005721674 6:28608400-28608422 CCCGTAGGGTACCCAAAGTCCGG - Intronic
1006151115 6:31990529-31990551 CCTGTAGGGTACCTGAAGTCTGG + Intronic
1006157416 6:32023267-32023289 CCTGTAGGGTACCTGAAGTCTGG + Intronic
1013808462 6:114018319-114018341 CTCGTAGGGTACCCGAAGTCCGG - Intergenic
1014526209 6:122504869-122504891 TCCGTAGGGTATCCGAAGTCCGG + Intronic
1015400039 6:132778302-132778324 TCCATAAGGTACCCAATGTCAGG - Intronic
1022249590 7:28593986-28594008 TCCGGAAGGAACCCAAAGTCAGG - Intronic
1028192262 7:87867028-87867050 CCCAGTGGGTACCCCAAGTCTGG - Intronic
1034367168 7:150561096-150561118 ACCTGCGGGTACCCAAAGTCTGG + Intergenic
1037945169 8:22985114-22985136 CCCATAGGGTACCCAAAGTCTGG + Intronic
1040787072 8:51178618-51178640 CCCAGAGGGTACCCTGAGTCTGG + Intergenic
1045478766 8:102576064-102576086 CCCGTGGGGTACCCATAGCTGGG + Intergenic
1052993976 9:34539846-34539868 CCCGTAGGGTACCTGAAGTCTGG + Intergenic
1056338839 9:85603677-85603699 CCCCTAGGGTCCCCAATTTCAGG + Intronic
1056593411 9:87984170-87984192 CCCGTAGGGTACCCAAAGTCCGG + Intergenic
1056753580 9:89368482-89368504 CCAGAAGGGTCCCCAGAGTCTGG - Intronic
1058857039 9:109072586-109072608 CCCGTAGGGTACCTGAAGTTCGG - Intronic
1062713258 9:137988214-137988236 CCCGTAGGGTCCTGAATGTCAGG + Intronic
1203759663 EBV:5597-5619 CCCGTGGGGTGCCCAAAGGCGGG - Intergenic
1190556057 X:51637016-51637038 CCAGTAGGGTACCCAAAGTCTGG - Intergenic
1195295217 X:103469896-103469918 CCCGTAGGGTACCCAAAGTCCGG + Intergenic
1196313945 X:114200836-114200858 CCCCTAAGGCACCAAAAGTCAGG + Intergenic
1201346831 Y:12993896-12993918 CATGTAGGGTACCCAAAGTCTGG + Intergenic
1201668931 Y:16493256-16493278 TCCGTAGGGTACCCAAAGTCTGG - Intergenic