ID: 1005725956

View in Genome Browser
Species Human (GRCh38)
Location 6:28648990-28649012
Sequence TTGAAGAACCAAAATGAGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 420
Summary {0: 1, 1: 0, 2: 2, 3: 29, 4: 388}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1005725956_1005725958 13 Left 1005725956 6:28648990-28649012 CCTTCCTCATTTTGGTTCTTCAA 0: 1
1: 0
2: 2
3: 29
4: 388
Right 1005725958 6:28649026-28649048 GTTTCCTAATATCTTCCTTATGG 0: 1
1: 0
2: 1
3: 21
4: 242

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1005725956 Original CRISPR TTGAAGAACCAAAATGAGGA AGG (reversed) Intergenic
900848130 1:5120204-5120226 TTTAAAAAACAAAATGAGCAGGG + Intergenic
902185856 1:14724846-14724868 TTGATGAACCAGAGTGAGGAAGG - Intronic
902586121 1:17439407-17439429 TTGAAGGAATAAAAAGAGGAAGG - Intronic
902711604 1:18243703-18243725 TTACAGAACCCAAATGAGGCTGG - Intronic
902813634 1:18903555-18903577 TTGAGGAACCAAAATCAGCATGG - Intronic
903107638 1:21097519-21097541 TTGAAAAACCAAAAGGAAGGGGG + Intronic
903257605 1:22113457-22113479 GTGAGGAACCAAATTGAGGATGG + Intergenic
904781322 1:32951135-32951157 TTGAAGAAAAAAAATGAAAAAGG - Intronic
906690136 1:47787105-47787127 GTGAAGAACCATGATGGGGAAGG + Intronic
909201764 1:72698406-72698428 TTCAAGAAACAAAAAGATGAGGG + Intergenic
909950081 1:81708709-81708731 TTGAAGCATAAAAATTAGGATGG + Intronic
910902485 1:92136405-92136427 CTAAAGAAACAAAATGAGGAAGG - Intronic
911082028 1:93942839-93942861 TTGAAAAACCAAAAGGTGGCCGG + Intergenic
911441835 1:97936748-97936770 TTTAAGAAAGAAATTGAGGAGGG - Intergenic
911931287 1:103907272-103907294 TTTAAGAATAAAAATGAGAAGGG - Intergenic
912917282 1:113828036-113828058 TTGAAGAAAATAAATGAGCATGG - Intronic
913256014 1:116954245-116954267 TGGCAGAACCATTATGAGGATGG - Intronic
914200893 1:145484377-145484399 TTTAACAGCGAAAATGAGGAAGG + Intergenic
914480006 1:148057505-148057527 TTTAACAGCGAAAATGAGGAAGG + Intergenic
914726031 1:150328506-150328528 TTGAAGAAGCAAAAGGTGCATGG + Intronic
916159926 1:161899494-161899516 TTTAAGTACCAAAATCTGGAAGG - Intronic
916212466 1:162369994-162370016 TAGAAGAATGAAAAAGAGGAAGG - Exonic
916350549 1:163844844-163844866 ATTAAGAACCAATATGAGGAAGG - Intergenic
916565294 1:165970639-165970661 TTGAAGAAGAAAAATAAGAAAGG - Intergenic
917105921 1:171491960-171491982 TTGAAGAAGCACAATAGGGAAGG + Intronic
917816373 1:178713785-178713807 ATTAAAAACCAAAAAGAGGACGG + Intergenic
918071834 1:181139074-181139096 TTGAAACACAAAACTGAGGAAGG - Intergenic
918344921 1:183598750-183598772 TTGAAGACCCAGATAGAGGATGG + Intergenic
919103689 1:193123148-193123170 TCAAAGAAACAAAATGAGTAGGG - Intronic
919548448 1:198953234-198953256 TTAAAGAAGGAGAATGAGGAAGG - Intergenic
919676778 1:200391740-200391762 TTGGGGAAACAAAATGAGGAAGG + Intergenic
920193795 1:204212876-204212898 TTGAAGAACAACAAGGAGGTGGG - Intronic
920622921 1:207565990-207566012 TTGAAGAATCACATTGAGGGAGG - Intronic
920701024 1:208218110-208218132 TAGAAAAACCAAAATGCAGAAGG - Intronic
921560267 1:216649349-216649371 TTGGTGAATGAAAATGAGGATGG - Intronic
921562753 1:216677945-216677967 TTGCAGCATCAGAATGAGGAAGG - Intronic
921781141 1:219165988-219166010 TTGAAGAAGTAAATAGAGGAGGG + Intergenic
922895529 1:229097177-229097199 AAGAAGAGCCAAAATCAGGAAGG + Intergenic
923841441 1:237676046-237676068 CCGAAGAACAAAAATGAGGTAGG + Intronic
924797887 1:247305648-247305670 GTGAAAAACCAAAATGATAAAGG + Intronic
1063893926 10:10659486-10659508 TTGAAGCAAGAAGATGAGGAGGG - Intergenic
1063898814 10:10710804-10710826 TTTAAAAAAGAAAATGAGGAGGG - Intergenic
1064149482 10:12850537-12850559 TTGAATAAGCCAGATGAGGAAGG - Intergenic
1064326970 10:14360330-14360352 TTGAAGAGCCAAGATGTGGGTGG - Intronic
1064977150 10:21129164-21129186 TTAAAGAAAGAAAATGATGAAGG + Intronic
1066379896 10:34892328-34892350 TCGAGGAAACAGAATGAGGAGGG + Intergenic
1067521211 10:47007773-47007795 TTGAAGAAAGAAAATGGGGAGGG + Intergenic
1068626385 10:59253050-59253072 TTGAGGAAACAAAAACAGGAAGG + Intronic
1069127293 10:64652259-64652281 TTGCAGAACCAAAATTTGGCAGG + Intergenic
1069259241 10:66373272-66373294 TTAAAGAACTAAAATAAGAATGG - Intronic
1069771023 10:70900367-70900389 TTGAAGAAGAAAAATGAGATTGG - Intergenic
1070180792 10:74011525-74011547 TTGAAGAACTACCATGAGCAGGG - Intronic
1070655725 10:78269828-78269850 TTGGAGAACCCAAATGTGGGAGG + Intergenic
1071220756 10:83462481-83462503 TTGTAGAACCACCTTGAGGAAGG + Intergenic
1071492556 10:86145760-86145782 ATAAAGAACACAAATGAGGAAGG - Intronic
1071947951 10:90669157-90669179 TTGTGGAAACAAAAAGAGGAGGG + Intergenic
1071957977 10:90779752-90779774 TTGATGAACCACAAGGAGGCAGG + Intronic
1072133589 10:92521177-92521199 TAGAAAAACCAAAATTAGGGAGG + Intronic
1072161710 10:92772987-92773009 TTGAAAAATAAAAATGAGCATGG - Intergenic
1072451366 10:95541814-95541836 TTGAAGGACCAATAGGAGGGAGG - Intronic
1072946799 10:99817525-99817547 TTGAAGAGAAAAAGTGAGGATGG + Intronic
1073001208 10:100287383-100287405 TTGAAGGTGCAAAATGAGGAGGG + Intergenic
1074269285 10:111937244-111937266 TTGAAGAACAAGAATGACTATGG - Intergenic
1074835018 10:117283126-117283148 TGTAAGAACAAAAATGAGAAAGG - Exonic
1078018078 11:7632550-7632572 CTGAAGAACCAAGATCAGAAAGG + Intronic
1078313486 11:10270695-10270717 TTTAAGAAGTAAAATGAGGACGG + Intronic
1078381897 11:10849981-10850003 ATCAAGAACCAAAATGGGTACGG + Intronic
1078764820 11:14285803-14285825 TGGAAGAACAAAGATAAGGATGG - Intronic
1078861460 11:15251148-15251170 TGGAAGAAGCAAAATGAGTTTGG + Intergenic
1079395297 11:20057095-20057117 TTGAAAAAGCAGAATGTGGAGGG + Intronic
1080683554 11:34497055-34497077 TTGAAGAATCAGAAAGAGGATGG + Intronic
1080776276 11:35389764-35389786 TTTAAGAACAAAAAAGAGGCTGG - Intronic
1081039203 11:38189905-38189927 TTGAAGAACCAAAAGCATTACGG + Intergenic
1082741445 11:56916037-56916059 TAGAAGAACCAGAACCAGGATGG - Intergenic
1084915412 11:72425552-72425574 TTGTGGCAACAAAATGAGGAAGG - Intronic
1085338539 11:75716426-75716448 TTCAAGAACAGAGATGAGGATGG + Intergenic
1086554992 11:88098883-88098905 ATGAAGACCCAAAATGAAAATGG - Intergenic
1087964766 11:104399012-104399034 TTCAATAACAAAATTGAGGATGG - Intergenic
1088553021 11:111033794-111033816 TTGGAGACGCAAAATGGGGAGGG + Intergenic
1090793890 11:130117396-130117418 CTGAAGAACTGAAATCAGGAGGG - Intronic
1093364823 12:18280928-18280950 TAGAAGAAGAAAGATGAGGAAGG + Intronic
1093427163 12:19041050-19041072 TTGGAGAACAAAGCTGAGGAAGG + Intergenic
1093602199 12:21041434-21041456 TTGATGAAAGAAATTGAGGAGGG - Intronic
1094740667 12:33284745-33284767 TTGAAGGAACAAAATAATGAGGG + Intergenic
1095302881 12:40607469-40607491 GGGAAGAACAAAAATAAGGAAGG - Intergenic
1095518889 12:43038332-43038354 GTGAAGAAAGAACATGAGGAAGG - Intergenic
1095759738 12:45816979-45817001 TTGTAGAACTAAAATTAGCATGG + Intronic
1097152195 12:56987287-56987309 TTGAACAAGGACAATGAGGATGG + Intergenic
1097345993 12:58493023-58493045 TTGAAGAAGAAAAATGAAGTTGG - Intergenic
1097855416 12:64456542-64456564 TTCAAGAACCAAAAAGGGGCCGG + Intronic
1098203117 12:68078355-68078377 TTGAGGAACAAAGATGAGCATGG + Intergenic
1100005660 12:89892069-89892091 TTTATGAACCAAAATAAGGTAGG + Intergenic
1101112844 12:101503157-101503179 TAGAAGTTCCAAAATGAGAAGGG - Intergenic
1101205411 12:102482279-102482301 TGGAAAATCCAAAATGAGGGAGG + Intergenic
1101538882 12:105646247-105646269 CTGATGAAACAAAATGAGGCTGG + Intergenic
1102154064 12:110710420-110710442 TTGAAAAACAAAAATTAGGCTGG + Intergenic
1105694612 13:22875568-22875590 TGGAAGAAACAAAAGGAGGGAGG + Intergenic
1106409891 13:29504315-29504337 TTGTAGAACCAAACTGAAGGGGG - Exonic
1106577088 13:30984965-30984987 TTTAAGAACAAAACTGAGGATGG + Intergenic
1107349579 13:39500099-39500121 TTGAAGAAACATACTGAGGCAGG - Intronic
1108695538 13:52899492-52899514 TTGACTAACTAAAATGAGTAAGG - Intergenic
1108706109 13:52989255-52989277 TTAAAACACCAAAATGAGAAAGG - Intergenic
1108807476 13:54176715-54176737 ATGCAGACCCAAAAGGAGGAAGG + Intergenic
1109154425 13:58888347-58888369 ATGAAGAACTGAAATGTGGAGGG + Intergenic
1109207015 13:59493691-59493713 TTGAATAACCACAAGGATGAAGG - Intergenic
1110297233 13:73882080-73882102 TTGAAAATACAAAGTGAGGAGGG + Intronic
1111520855 13:89401834-89401856 TTGAAGGATGAAAATAAGGAAGG - Intergenic
1111782627 13:92748000-92748022 TTGAATAACCCAAACGATGATGG + Intronic
1111838364 13:93417560-93417582 TGAAATAACCAAAATGAGGTGGG + Intronic
1113021709 13:105894846-105894868 TGGAAGAATGAAAAGGAGGAAGG - Intergenic
1113141842 13:107161261-107161283 TTGAAGGAGGAAGATGAGGAGGG + Intergenic
1113322226 13:109245223-109245245 ATGAAGAAAGAAAATGAGAAGGG - Intergenic
1113538624 13:111088337-111088359 TTAAAGGAAAAAAATGAGGAAGG - Intergenic
1113778106 13:112960461-112960483 TGCAACAACCAAAATGAGCAGGG - Intronic
1113872649 13:113570278-113570300 TTGAAGAACAATAATGTTGAAGG - Intergenic
1114441177 14:22749331-22749353 TTGCAGAATCAAAAGAAGGAAGG + Intergenic
1114482849 14:23046194-23046216 TTGCAGAACACAAAGGAGGAGGG - Intergenic
1114488980 14:23084308-23084330 TTAAAAAATCAAAATGAGGCTGG + Intronic
1115665329 14:35538745-35538767 TTTAAGCACCAAAAAGAAGATGG - Exonic
1116571438 14:46522049-46522071 TTAAAGCACCAATATGTGGATGG + Intergenic
1117313083 14:54547884-54547906 TTAAAGAACCAGGCTGAGGAAGG - Intergenic
1117452920 14:55868808-55868830 TTGAATAACCCAAAAGAAGAAGG - Intergenic
1117548261 14:56810309-56810331 TTAAAGAACGAAAATGAGGAAGG + Intronic
1117922403 14:60738829-60738851 ATTAAGAGCCAAAATGAGGCTGG - Intronic
1117953974 14:61108634-61108656 TTGAAGAGTTAAAATGAGAATGG + Intergenic
1118840265 14:69504617-69504639 TAGAAGAAGAAAAATGAGGGTGG - Intronic
1118878525 14:69805978-69806000 TTGAAGAAACAATCAGAGGATGG + Intergenic
1119394488 14:74316219-74316241 TTAAAGAACCTAAATGAGGCTGG + Intronic
1120690892 14:87591059-87591081 ATGAGGAAGGAAAATGAGGATGG + Intergenic
1121661710 14:95640081-95640103 TTGCAGAAACCCAATGAGGAAGG - Intergenic
1123460192 15:20462914-20462936 TTGGAGAACCATAATAACGATGG - Intergenic
1123657870 15:22537503-22537525 TTGGAGAACCATAATAACGATGG + Intergenic
1124266412 15:28238685-28238707 TTGGAGAACCATAATAAAGATGG - Exonic
1124311781 15:28632702-28632724 TTGGAGAACCATAATAACGATGG + Intergenic
1126146364 15:45476440-45476462 ATAAAGAAGCAAAAAGAGGATGG + Intergenic
1126161314 15:45616224-45616246 TGGAAGAACAAAAGTGAAGAAGG + Intronic
1126939067 15:53745981-53746003 TAGAACAACCAAAATAACGAAGG - Intronic
1127743363 15:61937305-61937327 TTAAAGAACAAAAAATAGGAAGG + Intronic
1127869609 15:63060347-63060369 TGGAAGAACCAGAGAGAGGAAGG - Intronic
1127959583 15:63880740-63880762 TCACAGAACCAAAATGAGCAAGG + Intergenic
1128579593 15:68799740-68799762 TTAAAGAACAAATTTGAGGAAGG + Intronic
1128622967 15:69167450-69167472 TTTAAGAAAGAAAAAGAGGAAGG - Intronic
1129089363 15:73132349-73132371 GTGAAGAAACAAAAAAAGGATGG - Intronic
1129962042 15:79696081-79696103 TTACAGAAACAAAATGAAGAAGG - Intergenic
1130520435 15:84657460-84657482 TGGAAGCACCAAGAGGAGGAAGG - Intronic
1130555229 15:84918039-84918061 GTGGAGCACCAAAATGATGAGGG + Intronic
1130615622 15:85404356-85404378 TTGCAGAACCAAACTGTGGCAGG - Intronic
1130619097 15:85442708-85442730 TTGCTGAGCCAAAATCAGGATGG - Intronic
1131776238 15:95802313-95802335 TTAAAGAACCGAAAGGAGGCTGG - Intergenic
1132005194 15:98220175-98220197 TTGATGAACTAAGTTGAGGATGG - Intergenic
1134194837 16:12151664-12151686 ATGTAAAACCATAATGAGGAGGG - Intronic
1134288656 16:12884803-12884825 TTGATGAAACAAATTAAGGAAGG - Intergenic
1135617803 16:23927305-23927327 TTGAAGAACCAAAATCACTTTGG + Intronic
1135680691 16:24454290-24454312 TTTACCAACCATAATGAGGATGG + Intergenic
1135857735 16:26027523-26027545 TTGGAGAAGCAAAATGAGATAGG - Intronic
1136656994 16:31715377-31715399 TTGAAGAACAAAAAGGAAGGGGG + Intronic
1136704607 16:32176098-32176120 TTGGAGAACCATAATAAAGATGG - Intergenic
1136763306 16:32753308-32753330 TTGGAGAACCATAATAAAGATGG + Intergenic
1136804794 16:33117078-33117100 TTGGAGAACCATAATAAAGATGG - Intergenic
1137593027 16:49705424-49705446 TTGCAGAACAAGAATGTGGATGG + Intronic
1138847429 16:60583579-60583601 ATGAAGAATCAAGATGATGAAGG + Intergenic
1139156618 16:64450840-64450862 ATGAGGAACCAAAAAGATGAGGG + Intergenic
1140185189 16:72763338-72763360 TTGAAGAAAGAAGAGGAGGAGGG + Intergenic
1141544148 16:84752465-84752487 TAAAAGAATAAAAATGAGGAAGG - Intronic
1203065456 16_KI270728v1_random:1013629-1013651 TTGGAGAACCATAATAAAGATGG + Intergenic
1143105637 17:4529374-4529396 TTAAAGAACAAACATGAGGCTGG - Intronic
1145848013 17:28060604-28060626 TTGAAGAACCCAACAGAGAATGG + Intronic
1146272453 17:31493309-31493331 TTGAGGTACCAGAAAGAGGAAGG + Intronic
1147542548 17:41372801-41372823 TTGAAGTCCCACAATGAGGAAGG - Intronic
1147907803 17:43833906-43833928 TTGCAGAACCAAAATAAGAATGG - Intergenic
1148245602 17:46027942-46027964 TTGGAGAACAAAGATGAGGAGGG - Exonic
1148997652 17:51725274-51725296 TTGAATAACCCATATGAGAAAGG + Intronic
1149252554 17:54787065-54787087 TTAAAATACCAAAATGAGAAAGG + Intergenic
1149520106 17:57312331-57312353 TTGAAAAAGAAAAATTAGGAAGG - Intronic
1150022932 17:61638723-61638745 TTGATGAAAGAAATTGAGGAGGG + Intergenic
1150204531 17:63392357-63392379 TTGAAAATCCAGAAAGAGGAGGG - Intronic
1150995900 17:70317152-70317174 TGGAAGATGCAAAATGAGGTTGG - Intergenic
1151122740 17:71810529-71810551 ATGGAAAACCAAAACGAGGAGGG + Intergenic
1151374714 17:73679283-73679305 TTGAATAATCAAACTGATGAAGG - Intergenic
1153414802 18:4834964-4834986 TTGAAAAAATAAAATGAGGCCGG - Intergenic
1154384699 18:13882460-13882482 TCTAAGAAACAAAATGAAGATGG - Exonic
1155826475 18:30450075-30450097 TTAAAAACCCAAAATGAGGAAGG - Intergenic
1155998275 18:32356103-32356125 TTTAAGGAGCAAAATGAGAAAGG + Intronic
1156333166 18:36144632-36144654 TTGTTAAACCACAATGAGGAAGG - Intronic
1156768652 18:40690962-40690984 TTGAAGAACAAACAAGAAGATGG - Intergenic
1158173057 18:54620727-54620749 TTGCAGAAATAAAATGTGGAAGG - Intergenic
1158971750 18:62674602-62674624 CTGAAGAACTAAAAGCAGGAAGG - Intergenic
1159124326 18:64205554-64205576 TTGAAAAAAGAAAATGAAGAAGG - Intergenic
1159734659 18:72079826-72079848 TTTAACAACAAAAATGAGTATGG - Intergenic
1163912233 19:20206520-20206542 TTGAAGAAGTAGAATCAGGAAGG + Intergenic
1166108860 19:40610869-40610891 ATGGAGAAGCAGAATGAGGAGGG + Intronic
1166211118 19:41307052-41307074 TTTAAAAAGCAAAATGGGGAGGG + Exonic
1166886632 19:45965223-45965245 TTGAAGAAGCAGAGAGAGGACGG - Intronic
1167723677 19:51196607-51196629 TTGGAGACTCAGAATGAGGAAGG - Intergenic
1167797748 19:51720753-51720775 TGGAAGAAACAAAATCAGGCTGG - Intronic
1168192024 19:54745658-54745680 TTAAAGAACTAAAAAGAGGTTGG - Intronic
1168194307 19:54762215-54762237 TTAAAGAACTAAAAAGAGGTTGG - Intronic
1168196356 19:54776936-54776958 TTAAAGAACTAAAAAGAGGTTGG - Intronic
1168204714 19:54841192-54841214 TTAAAGAACTAAAAAGAGGTTGG - Intronic
925852963 2:8101040-8101062 TTGAAGAAGCAGAAAGAGCAAGG - Intergenic
926599455 2:14826072-14826094 TTCAAGAGGCTAAATGAGGAGGG + Intergenic
926623864 2:15073180-15073202 TTTAAGAAGTAAAATAAGGATGG + Intergenic
927300900 2:21513075-21513097 TTCAAAAAGAAAAATGAGGAGGG - Intergenic
927490829 2:23519799-23519821 AGGAAGACCCAAAGTGAGGAGGG + Intronic
928299320 2:30111592-30111614 TTTCAGAAACAAAATGATGAAGG - Intergenic
928937579 2:36695312-36695334 TTGCAGAACCAAAAGAAGTAAGG + Intergenic
929212070 2:39368089-39368111 TGGAAGGCCCAAAATAAGGAAGG + Intronic
929940334 2:46328909-46328931 TTTATGAACAAAAAGGAGGAGGG - Intronic
931165826 2:59746680-59746702 TGGAAGAAAAAAAAAGAGGAAGG + Intergenic
933002700 2:76945917-76945939 GTGAAGAACAAGAATGAGAAGGG - Intronic
933126001 2:78606907-78606929 TTAGAGAAAAAAAATGAGGAAGG + Intergenic
934155017 2:89190828-89190850 TTGAATAAATAAAATGAGGTAGG - Intergenic
934212298 2:89991896-89991918 TTGAATAAATAAAATGAGGTAGG + Intergenic
936869966 2:117124855-117124877 CAGAAGAACCAAAATGCTGAGGG + Intergenic
937053976 2:118915374-118915396 TTCAAGAACCAAAGTTTGGAGGG - Intergenic
937519570 2:122695647-122695669 TTTAAGAAGCAAAGTGAAGAAGG - Intergenic
937539487 2:122931077-122931099 TTGCCCAAACAAAATGAGGATGG - Intergenic
938613020 2:132968885-132968907 CTGAAGAACTAAAAAGAAGAGGG + Intronic
939467551 2:142578404-142578426 ATGAAGAAGCCAAAGGAGGATGG - Intergenic
940364117 2:152827211-152827233 TTGAAGAAAGAAAATGAAGTAGG + Intergenic
940442438 2:153733941-153733963 TTGAAGAAATAAAAAGGGGATGG - Intergenic
940841870 2:158593136-158593158 TAGAAGAATAGAAATGAGGAAGG + Intronic
940880042 2:158937496-158937518 CTGAAAAAACAAGATGAGGAGGG - Intergenic
941651494 2:168097327-168097349 CTGTAGAACCTAAATGAGGTGGG - Intronic
941749570 2:169120479-169120501 TAGAAGAACCAAAATAGGGCTGG + Intergenic
942798862 2:179852967-179852989 TTTAAGACTCAAAATGAAGAAGG - Intronic
943678358 2:190740583-190740605 TTTAAGTAACAAATTGAGGATGG - Intergenic
944086145 2:195850168-195850190 GAGAATAACCAAAATGAGCATGG + Intronic
944681295 2:202079346-202079368 TCAAAGAGCCAAAGTGAGGATGG + Intronic
945672761 2:212821855-212821877 TTGTAGCACCAAATAGAGGAAGG + Intergenic
946655411 2:221940504-221940526 CTCAAGAGCCAAAATGAGGAGGG - Intergenic
947182303 2:227422010-227422032 ATTAAGAAGCAAAATGAGGCTGG - Intergenic
947804526 2:232956469-232956491 TTTAAGAACCAGAATTAGGCTGG + Intronic
948394241 2:237632655-237632677 TTGGAGAACCAAGCTGGGGATGG + Intronic
1169655059 20:7913757-7913779 TTGAAGAAAGAAAATAATGAAGG - Intronic
1170372008 20:15659446-15659468 TTGAAGAACTAAAAGAAGGTGGG - Intronic
1171365503 20:24620271-24620293 TTCAAGAAGCAGCATGAGGATGG + Intronic
1172017583 20:31887190-31887212 TTGCAGAACCAAAATTACAAGGG + Exonic
1172874409 20:38155642-38155664 TTATAGAAACAAAATGAGGCCGG - Intronic
1173674511 20:44822128-44822150 TTCAAGAAACAAAACGAGGAGGG - Intergenic
1174725341 20:52855838-52855860 ATGAAGAAAAACAATGAGGAAGG - Intergenic
1175127861 20:56765781-56765803 TTGAACAAACAAAATAAGAACGG + Intergenic
1177341185 21:19802334-19802356 TTGAAATACCAAATTGAGTATGG - Intergenic
1177907735 21:26992407-26992429 TTGAGGAACCAAAACATGGATGG - Intergenic
1182263153 22:29090652-29090674 TTGAAGAAAAAAAATAAGGGAGG + Intronic
1182470623 22:30546053-30546075 TTAAAGAACTAAAAAGAGGCTGG - Intronic
1184064602 22:42110518-42110540 TTGAAGAAACAGAGTCAGGAAGG - Intergenic
1184970232 22:48014495-48014517 TTTAAGAATCAAAAGGAGGCCGG - Intergenic
949639291 3:6016829-6016851 TTAAAGGATCAAAATGAAGATGG - Intergenic
949817598 3:8076340-8076362 ATCAAGAGCCAAAAGGAGGAAGG - Intergenic
950960888 3:17105790-17105812 TAGAAGAGCAAAAATAAGGATGG + Intergenic
953435561 3:42874731-42874753 TTCATGAACCAACCTGAGGAGGG + Exonic
954807435 3:53228716-53228738 TTGGAGAACCCAACTCAGGAGGG + Intronic
954978307 3:54718616-54718638 TTGAAGAATCAAAATGATATTGG - Intronic
955914844 3:63896550-63896572 CTGAAGAAACAGATTGAGGAAGG - Intronic
956318656 3:67969413-67969435 CTGAAGAACACAAATGAAGAAGG - Intergenic
956697089 3:71927810-71927832 TTGGAGAAGCAAAGTGAAGATGG - Intergenic
956740719 3:72273669-72273691 TTTAAGAAACACAATTAGGAAGG + Intergenic
957690845 3:83565423-83565445 TGTAAGAACCATAATAAGGAAGG + Intergenic
957950736 3:87122771-87122793 TTAAAAAAACAAAATAAGGAAGG + Intergenic
959090588 3:101898715-101898737 TTTATGAACAAAAATGAAGATGG + Intergenic
960824146 3:121765800-121765822 ATGAAAAACCAAAAGGAGCAGGG - Intergenic
962058307 3:131897894-131897916 TTAAAGAAAAAAAAAGAGGATGG + Intronic
962872133 3:139506620-139506642 TTTAAACACCAAAATGAGCAGGG + Intergenic
963706895 3:148698716-148698738 TTGAATAATCAAACTGAGGAAGG + Intronic
966572105 3:181455292-181455314 TTTAAAAACCTAAATAAGGAGGG + Intergenic
966921489 3:184614573-184614595 TGAATGAACAAAAATGAGGAAGG + Intronic
968466777 4:755874-755896 CTGAAGAAGAAAAATGAGGAGGG - Intronic
969832257 4:9807287-9807309 TAGAAGAAATAAAATGAGCAGGG - Intronic
970243826 4:14037722-14037744 TGGAAGAACCAAAAAGATGGTGG + Intergenic
970564733 4:17320686-17320708 TTGGAGAACCAAAAAGAAGAAGG - Intergenic
971577401 4:28293226-28293248 TTGAAGAAGCAGAAAGATGAAGG + Intergenic
972250106 4:37290801-37290823 GTGAAGAGCAAAAATGATGATGG - Intronic
973996225 4:56462124-56462146 ATGAAGAATCAAAATGAGGACGG + Intergenic
974546976 4:63324028-63324050 ATGATGAACTAAAATGAAGATGG + Intergenic
975445461 4:74459041-74459063 TCGAAGAAAAAAAATGAAGAAGG - Intergenic
977177199 4:93831998-93832020 ATGAAGCACCAAAAAGAGCAAGG + Intergenic
977831360 4:101597466-101597488 AGGAAGAAACAAACTGAGGATGG - Intronic
978635835 4:110804956-110804978 TTCAAGTTCCAATATGAGGAGGG - Intergenic
979610896 4:122687816-122687838 TTGAAGAACAAAGAGGAGGTTGG + Intergenic
979955770 4:126952156-126952178 TGGATGAATCAAAATGAGTATGG - Intergenic
980663993 4:135904448-135904470 GTGAAAAAACAAAAGGAGGAGGG + Intergenic
981330256 4:143500002-143500024 TTCAAGCACCAGAATGAGAAGGG - Intergenic
981978924 4:150768270-150768292 TAGAGGAATCAACATGAGGAAGG + Intronic
983061674 4:163167407-163167429 TTGAAGCGCCAAAATGAAGCAGG + Intergenic
983443063 4:167812957-167812979 TTTAAGAAAGAAGATGAGGAAGG - Intergenic
984629408 4:182045012-182045034 TTGTAGAACAAAAATCAGAATGG + Intergenic
984677620 4:182568374-182568396 TTGGAGAAACAGAATGAGAAGGG + Intronic
984968645 4:185166076-185166098 TTGAAGGCCAAAAATTAGGAAGG - Intronic
986220299 5:5763060-5763082 TTAAAGAACCAAATAGAGAAAGG - Intergenic
987176624 5:15317819-15317841 TTGAATAAATTAAATGAGGATGG - Intergenic
987225426 5:15835437-15835459 TTTAAGAACCAATATTAGAATGG + Intronic
989391673 5:40906997-40907019 GTAAAGAACAAAAATAAGGAAGG + Intergenic
989429746 5:41338939-41338961 TAAAAGAACCAGAATGAGGGCGG - Intronic
992073896 5:73173663-73173685 CTGGAGAACCATAAGGAGGAGGG - Exonic
992684067 5:79182082-79182104 TTTAGAAACCAAAATGGGGAGGG + Intronic
993166268 5:84358426-84358448 TTGAAGAACCTAAATGGTGGTGG + Intronic
993243407 5:85420387-85420409 TTGAAGAAGCTTAATTAGGATGG - Intergenic
993860714 5:93133535-93133557 TTGAAGAACCAGATTTAGGAAGG - Intergenic
994473557 5:100239376-100239398 TTGAACAAAGAAAATTAGGAGGG - Intergenic
994506978 5:100655814-100655836 GTGAAGAGCTAAACTGAGGAAGG - Intergenic
995831555 5:116360791-116360813 TTGAAAGACCAAAAAGAGCATGG + Intronic
996277825 5:121689043-121689065 ATGAAGAGCAAAAATGGGGAAGG + Intergenic
996563650 5:124857319-124857341 TTGAAGAACAACAAAGAGGCCGG + Intergenic
996942280 5:129022657-129022679 TTACAGAATAAAAATGAGGAGGG + Intronic
998500967 5:142632304-142632326 TTGAGTAACCAAAATGACTAAGG + Intronic
999754655 5:154655358-154655380 TTTTAGAACCCCAATGAGGAAGG + Intergenic
1001798519 5:174523022-174523044 TGAAAGAACCAAAAACAGGAAGG - Intergenic
1003569803 6:7248348-7248370 TTGAACCAGCAAACTGAGGACGG - Intronic
1003792712 6:9565120-9565142 TTGGAGAAAGAAAATAAGGAAGG - Intergenic
1004009735 6:11671403-11671425 TTCAAAAACAAAAATGAAGAAGG + Intergenic
1004027520 6:11833603-11833625 GTGAAGAATCAGAGTGAGGAAGG + Intergenic
1004174167 6:13324440-13324462 TTTAAGAAAGAAAAGGAGGATGG + Intronic
1004804305 6:19185346-19185368 TTGAAGAAGCACACTGAGAAAGG + Intergenic
1005304423 6:24499415-24499437 TTAAAAAAAGAAAATGAGGAAGG - Intronic
1005725956 6:28648990-28649012 TTGAAGAACCAAAATGAGGAAGG - Intergenic
1006469931 6:34223059-34223081 TTGAAGAAGCAGGATGATGATGG + Intergenic
1008124751 6:47655650-47655672 CTAAGGAAACAAAATGAGGAAGG + Intergenic
1008591555 6:52998534-52998556 TTAAAGGACAAAAATGACGATGG + Intergenic
1008702532 6:54118003-54118025 TTGATGAAAGAAAATGAGAAAGG + Intronic
1009435852 6:63617807-63617829 ATGAAGAGCAAAAATGAAGATGG - Intergenic
1010338553 6:74720215-74720237 ATCAACAACCAAAATGATGAGGG - Intergenic
1010568991 6:77455002-77455024 TTGGAGATTTAAAATGAGGAGGG + Intergenic
1010863754 6:80946829-80946851 TTGAAGTAGATAAATGAGGAAGG - Intergenic
1012330965 6:97986600-97986622 AGGAAGAACAAAAATGAGGGTGG + Intergenic
1012993859 6:105953483-105953505 AAGAGGAACCAAAATGAAGATGG - Intergenic
1014517074 6:122393003-122393025 TTGAAAAACCCGAATTAGGAAGG - Intergenic
1014894787 6:126888703-126888725 TAGAAGATACAACATGAGGAAGG - Intergenic
1014925518 6:127266433-127266455 TTCAAGAAAAAAAATGGGGAGGG - Intergenic
1015103087 6:129504325-129504347 TTGTTGAACCACAATGAGGCTGG + Intronic
1015208152 6:130665503-130665525 TTGAATTACCGAAAAGAGGAAGG + Intergenic
1015495467 6:133877836-133877858 TTGAAGAAAAAAAATGGGCATGG + Intergenic
1015890735 6:137967600-137967622 TTGGAGAACAAAATTGTGGATGG - Intergenic
1016573961 6:145546825-145546847 TTGAAGGGGTAAAATGAGGAGGG - Intronic
1017268100 6:152474853-152474875 TGGAATAAGAAAAATGAGGAAGG + Intronic
1018393934 6:163362574-163362596 GTGAGGAACCAAAATAAGGCAGG + Intergenic
1018607575 6:165614176-165614198 TTGAGGAACAAAACTGAAGAAGG - Intronic
1018920950 6:168173422-168173444 TTTAATGACAAAAATGAGGAAGG + Intergenic
1019702650 7:2481445-2481467 GTAAAGAACCAAGATGGGGATGG + Intergenic
1019971119 7:4541684-4541706 TTGAAGAAGGAAAACAAGGAAGG - Intergenic
1021061211 7:16115139-16115161 ATAAAGAACCAAACTGAAGAGGG + Intronic
1022131058 7:27405027-27405049 ATGGAGAACCAAAAATAGGAAGG + Intergenic
1023085848 7:36569237-36569259 TTGCTAAAACAAAATGAGGAAGG + Intronic
1025010871 7:55397163-55397185 TTTAAAAAGCAAAATGAGGCTGG + Intronic
1026309103 7:69168297-69168319 ATTAAGAGCCAGAATGAGGACGG + Intergenic
1026725855 7:72869422-72869444 TTGAAGGACAAAAATGAGCTGGG - Intergenic
1027588866 7:80092378-80092400 CTAAAGAACCAAAATTAAGACGG - Intergenic
1027744478 7:82056335-82056357 TTGGAGAAGCAACATGAGGATGG + Intronic
1028105566 7:86873736-86873758 TTGATGAAAAAAATTGAGGATGG + Intergenic
1028944746 7:96564634-96564656 TAGAGGAACCAAAAGGTGGAAGG + Intronic
1030069864 7:105689271-105689293 GGGAAGAATCAAAGTGAGGAAGG + Intronic
1031268892 7:119619658-119619680 CTTAAGTTCCAAAATGAGGAAGG + Intergenic
1032118903 7:129142191-129142213 TTTAAAAAGCAAAATGAGGCCGG - Intergenic
1033724487 7:144099367-144099389 TTGAAAAACTAAAATTAGTAGGG + Intergenic
1033897580 7:146093716-146093738 GTGAAGAAACAAAGTGAGAAGGG + Intergenic
1034240459 7:149606722-149606744 TTGAACAACCAAAATAACAAAGG - Intergenic
1034775605 7:153823957-153823979 TTGAATAATCAAAATCAAGAGGG - Intergenic
1034827411 7:154278457-154278479 TTGACGATGCAAAATGACGATGG + Intronic
1035662388 8:1358005-1358027 TTGACAAACCAAATGGAGGAAGG + Intergenic
1035815615 8:2536913-2536935 TTGATGAAAGAAATTGAGGAGGG - Intergenic
1035927432 8:3743624-3743646 TTTAGGAACCAAAAAGGGGAAGG - Intronic
1036703686 8:11030819-11030841 TGAAAGCCCCAAAATGAGGAGGG + Intronic
1037555681 8:20019959-20019981 CTGAAGAACCAAACACAGGAAGG - Intergenic
1039027500 8:33273513-33273535 TTGTAAAAGCAAAATGAGAAAGG + Intergenic
1039543899 8:38393863-38393885 TTTAAGAACCAAGCTGAGCATGG + Intronic
1039773195 8:40709704-40709726 TTTAATAACCAAAATGACTATGG + Intronic
1041318337 8:56587621-56587643 TTGGAGAACCAACATGAGAAAGG + Intergenic
1043211056 8:77518505-77518527 TTGAAGAATGAAAATGAGAGAGG + Intergenic
1043515856 8:80993960-80993982 TTAATGAACCTAAATGAGCATGG - Intronic
1044533356 8:93333004-93333026 AGGAAGAAACAAAATGAGGAAGG + Intergenic
1044675517 8:94724468-94724490 TTAAAGAGGCATAATGAGGAAGG + Intronic
1044927457 8:97221716-97221738 TTGAAGACACACAATGAAGAAGG + Intergenic
1045276670 8:100712617-100712639 TTGAACAACCAAAATAAGACAGG - Intronic
1045584004 8:103510494-103510516 TTCAACAACCCAAATGAGCAAGG - Intronic
1046522505 8:115343447-115343469 TTGCAGAAGGAAAATGGGGAAGG - Intergenic
1046629181 8:116606424-116606446 TTGACAAACCTAAATGTGGATGG - Intergenic
1047838652 8:128722114-128722136 TTGAAGAAACAGAATGAGAGTGG - Intergenic
1048155851 8:131950234-131950256 CTGAAGTAGCAAAATGAGAATGG + Intronic
1048557466 8:135494576-135494598 CTCAAGAAACAAAAGGAGGAGGG - Intronic
1049033521 8:140056043-140056065 TTGAAAAACCAAAATAAAGCTGG + Intronic
1049713664 8:144079113-144079135 TTGAAGAGCCGCAAAGAGGAAGG - Intronic
1050102305 9:2131682-2131704 TAGAAAAAACAAAATGAGGCCGG + Intronic
1052695541 9:31872747-31872769 TAAAAGAACCAAAAAGAGAATGG + Intergenic
1053528791 9:38857078-38857100 ATGAAGAAGCCAACTGAGGAAGG + Intergenic
1053564699 9:39236878-39236900 TTGAACAACCACAATGAAAATGG - Intronic
1054132453 9:61382156-61382178 TTGAACAACCACAATGAAAATGG + Intergenic
1054201018 9:62081511-62081533 ATGAAGAAGCCAACTGAGGAAGG + Intergenic
1054637341 9:67506852-67506874 ATGAAGAAGCCAACTGAGGAAGG - Intergenic
1057344052 9:94231987-94232009 CTGAAGAAACAAAGTGAGGTGGG + Intergenic
1058493399 9:105527305-105527327 TTTAAGCACCAAAAAGAAGATGG + Intronic
1059072036 9:111147907-111147929 TTGCATAAACAAAAAGAGGATGG + Intergenic
1060835245 9:126750938-126750960 GTGAACAACCAAATTGAGGAAGG + Intergenic
1185956456 X:4496115-4496137 TTGAAGGAGCAAATTGAAGATGG + Intergenic
1186318590 X:8398964-8398986 TATAAGAAGCAAAAAGAGGACGG - Intergenic
1186322374 X:8443021-8443043 TTGAAGAAGAAAAATGATTATGG - Intergenic
1186441285 X:9588897-9588919 TTTAAAAATCAAAATGAGGACGG - Intronic
1186854613 X:13613893-13613915 TTGAAGAAAAAAAATGGGGATGG - Intronic
1188811099 X:34655866-34655888 TTGAAGAATCAAAATTAGAAAGG + Intronic
1189165540 X:38857419-38857441 TTTGGGAAACAAAATGAGGAGGG - Intergenic
1189716803 X:43875433-43875455 TTGAATATTCAAAATCAGGAAGG + Intronic
1190746390 X:53325221-53325243 TAGAAGAAACAAGATAAGGACGG - Intergenic
1190756092 X:53403415-53403437 TTAAAGAACAGAAATCAGGAGGG - Intronic
1190762496 X:53448213-53448235 TTGAAGAAATAAAAGGAGGCCGG - Intergenic
1191110715 X:56801480-56801502 TTGCAGAACAAAAGTGAGAAAGG + Intergenic
1192125384 X:68497171-68497193 TTGTAGAAAGAAAATCAGGAAGG - Intergenic
1194247067 X:91528147-91528169 TTGAAAAGCCAATATGAAGATGG + Intergenic
1194370701 X:93067534-93067556 TTGGAAAACCAAAAAGAGCAAGG + Intergenic
1194769346 X:97882140-97882162 TGGAAGAGGTAAAATGAGGATGG - Intergenic
1195426442 X:104737808-104737830 TAGAAGAGCAAAAATGAGGCTGG - Intronic
1195526248 X:105893385-105893407 GTGAAGAAGCAAAATATGGAGGG - Intronic
1196058366 X:111381066-111381088 TTTAAGAAACAAAATGTTGATGG - Intronic
1196461069 X:115931720-115931742 TTCAAAAAAAAAAATGAGGAGGG - Intergenic
1197150048 X:123210192-123210214 TTTAGGAAGCAAAAGGAGGATGG - Intronic
1197174964 X:123475824-123475846 TTGAAGAGCAAAAATAAAGAGGG + Intronic
1197905429 X:131419861-131419883 TTGAAGAAGAAAAATAATGAAGG + Intergenic
1199704886 X:150415509-150415531 TTGCATAAGCAAAAAGAGGAAGG + Intronic
1199707809 X:150445872-150445894 TTCAATAAGAAAAATGAGGAAGG + Intronic
1200566088 Y:4769685-4769707 TTGAAAAGCCAATATGAAGATGG + Intergenic
1200678493 Y:6179427-6179449 TTGGAAAACCAAAAAGAGCAAGG + Intergenic
1201479076 Y:14418056-14418078 TTGGAGAACAAATATGAGAAGGG + Intergenic