ID: 1005727489

View in Genome Browser
Species Human (GRCh38)
Location 6:28664107-28664129
Sequence CCACATAACAAGAGGTCAGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1005727489_1005727496 17 Left 1005727489 6:28664107-28664129 CCTTCTGACCTCTTGTTATGTGG No data
Right 1005727496 6:28664147-28664169 CATTTAAACGACTGATGGTCAGG No data
1005727489_1005727495 12 Left 1005727489 6:28664107-28664129 CCTTCTGACCTCTTGTTATGTGG No data
Right 1005727495 6:28664142-28664164 ATTCTCATTTAAACGACTGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1005727489 Original CRISPR CCACATAACAAGAGGTCAGA AGG (reversed) Intergenic
No off target data available for this crispr