ID: 1005727495

View in Genome Browser
Species Human (GRCh38)
Location 6:28664142-28664164
Sequence ATTCTCATTTAAACGACTGA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1005727487_1005727495 17 Left 1005727487 6:28664102-28664124 CCCTTCCTTCTGACCTCTTGTTA No data
Right 1005727495 6:28664142-28664164 ATTCTCATTTAAACGACTGATGG No data
1005727488_1005727495 16 Left 1005727488 6:28664103-28664125 CCTTCCTTCTGACCTCTTGTTAT No data
Right 1005727495 6:28664142-28664164 ATTCTCATTTAAACGACTGATGG No data
1005727492_1005727495 4 Left 1005727492 6:28664115-28664137 CCTCTTGTTATGTGGGACCAATA No data
Right 1005727495 6:28664142-28664164 ATTCTCATTTAAACGACTGATGG No data
1005727489_1005727495 12 Left 1005727489 6:28664107-28664129 CCTTCTGACCTCTTGTTATGTGG No data
Right 1005727495 6:28664142-28664164 ATTCTCATTTAAACGACTGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1005727495 Original CRISPR ATTCTCATTTAAACGACTGA TGG Intergenic
No off target data available for this crispr