ID: 1005728789

View in Genome Browser
Species Human (GRCh38)
Location 6:28675663-28675685
Sequence TCACCTTTACCCCTAACCCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1005728789_1005728794 3 Left 1005728789 6:28675663-28675685 CCAGGGGTTAGGGGTAAAGGTGA No data
Right 1005728794 6:28675689-28675711 GGCAGAGCACGGGATTTTTAGGG No data
1005728789_1005728791 -8 Left 1005728789 6:28675663-28675685 CCAGGGGTTAGGGGTAAAGGTGA No data
Right 1005728791 6:28675678-28675700 AAAGGTGAATAGGCAGAGCACGG No data
1005728789_1005728793 2 Left 1005728789 6:28675663-28675685 CCAGGGGTTAGGGGTAAAGGTGA No data
Right 1005728793 6:28675688-28675710 AGGCAGAGCACGGGATTTTTAGG No data
1005728789_1005728792 -7 Left 1005728789 6:28675663-28675685 CCAGGGGTTAGGGGTAAAGGTGA No data
Right 1005728792 6:28675679-28675701 AAGGTGAATAGGCAGAGCACGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1005728789 Original CRISPR TCACCTTTACCCCTAACCCC TGG (reversed) Intergenic
No off target data available for this crispr