ID: 1005737693

View in Genome Browser
Species Human (GRCh38)
Location 6:28764169-28764191
Sequence TCTCCCTCCGTTGAAGTGGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1005737693_1005737700 15 Left 1005737693 6:28764169-28764191 CCTCCCACTTCAACGGAGGGAGA No data
Right 1005737700 6:28764207-28764229 TCGCCCAGGCTGGAGTACAGCGG 0: 3055
1: 79524
2: 235125
3: 244512
4: 146324
1005737693_1005737705 30 Left 1005737693 6:28764169-28764191 CCTCCCACTTCAACGGAGGGAGA No data
Right 1005737705 6:28764222-28764244 TACAGCGGCGCGGAGTAGCTGGG No data
1005737693_1005737704 29 Left 1005737693 6:28764169-28764191 CCTCCCACTTCAACGGAGGGAGA No data
Right 1005737704 6:28764221-28764243 GTACAGCGGCGCGGAGTAGCTGG No data
1005737693_1005737703 20 Left 1005737693 6:28764169-28764191 CCTCCCACTTCAACGGAGGGAGA No data
Right 1005737703 6:28764212-28764234 CAGGCTGGAGTACAGCGGCGCGG No data
1005737693_1005737699 5 Left 1005737693 6:28764169-28764191 CCTCCCACTTCAACGGAGGGAGA No data
Right 1005737699 6:28764197-28764219 TCTCGCTCTGTCGCCCAGGCTGG 0: 26768
1: 89687
2: 191248
3: 194442
4: 151704
1005737693_1005737698 1 Left 1005737693 6:28764169-28764191 CCTCCCACTTCAACGGAGGGAGA No data
Right 1005737698 6:28764193-28764215 GGAGTCTCGCTCTGTCGCCCAGG 0: 20329
1: 57869
2: 114465
3: 140937
4: 148571

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1005737693 Original CRISPR TCTCCCTCCGTTGAAGTGGG AGG (reversed) Intergenic
No off target data available for this crispr