ID: 1005737768

View in Genome Browser
Species Human (GRCh38)
Location 6:28764933-28764955
Sequence GCTGAGGCTGCACTCAGCTG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1005737768_1005737774 18 Left 1005737768 6:28764933-28764955 CCCCAGCTGAGTGCAGCCTCAGC No data
Right 1005737774 6:28764974-28764996 TAAAGCTGAGCATACAGAGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1005737768 Original CRISPR GCTGAGGCTGCACTCAGCTG GGG (reversed) Intergenic
No off target data available for this crispr