ID: 1005743714

View in Genome Browser
Species Human (GRCh38)
Location 6:28816440-28816462
Sequence CTAAAAGATAAGTAGATCGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1005743714_1005743716 30 Left 1005743714 6:28816440-28816462 CCTGCGATCTACTTATCTTTTAG No data
Right 1005743716 6:28816493-28816515 CCTTTTCCTAGTTTTTCATATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1005743714 Original CRISPR CTAAAAGATAAGTAGATCGC AGG (reversed) Intergenic
No off target data available for this crispr