ID: 1005753999

View in Genome Browser
Species Human (GRCh38)
Location 6:28909423-28909445
Sequence TCCTGGAAGGTCATGGAATT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 233
Summary {0: 1, 1: 0, 2: 1, 3: 15, 4: 216}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1005753999_1005754008 17 Left 1005753999 6:28909423-28909445 CCCAATTCCATGACCTTCCAGGA 0: 1
1: 0
2: 1
3: 15
4: 216
Right 1005754008 6:28909463-28909485 GTTAAACTGTCTAGCGTACACGG 0: 1
1: 0
2: 0
3: 2
4: 35
1005753999_1005754006 -10 Left 1005753999 6:28909423-28909445 CCCAATTCCATGACCTTCCAGGA 0: 1
1: 0
2: 1
3: 15
4: 216
Right 1005754006 6:28909436-28909458 CCTTCCAGGAACTAGGACAGGGG 0: 1
1: 0
2: 5
3: 21
4: 220

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1005753999 Original CRISPR TCCTGGAAGGTCATGGAATT GGG (reversed) Intronic
904529915 1:31161635-31161657 CCCTGAAAGGTCATGGGCTTTGG - Intergenic
906278451 1:44536075-44536097 TGCAGGAAGGCCCTGGAATTGGG - Intronic
906441363 1:45848638-45848660 TCCTGGAGGATCATGGAACCTGG + Intronic
906965466 1:50452175-50452197 TCCTGGAAAGTCCTGGAATCTGG + Intronic
907090382 1:51718951-51718973 TGCTGAAGGGTGATGGAATTAGG - Intronic
907275355 1:53313944-53313966 TCCAGGAAGGGCATGGCAGTGGG + Intronic
907689346 1:56646119-56646141 TCCTGGAACGTGAAGGAATCTGG - Intronic
907964126 1:59312768-59312790 TCTTGGAAGGTTATGGTTTTTGG + Intronic
910286140 1:85556267-85556289 TCATGAAAGGTCATGGCAATGGG - Intronic
910371077 1:86515823-86515845 TACTGGTAGGGCATGGAAGTGGG + Intergenic
911104393 1:94118575-94118597 TCCTGGAAGCTCCTGGAATGTGG + Intronic
911157132 1:94647805-94647827 TCCATGAAGGTCATGGATGTAGG - Intergenic
912229050 1:107771207-107771229 TTCTGGAATCTGATGGAATTGGG + Intronic
912570314 1:110616452-110616474 TCCTGAAAGCTCCTGGACTTTGG - Intronic
913445256 1:118944144-118944166 TCCTGGAGGGTCTGGGAAGTTGG - Intronic
916575942 1:166066489-166066511 TAGTGGAAGGGCATGGAAGTTGG + Intronic
916781170 1:168031378-168031400 TGCTGGAAGGTCAAGTAAATTGG + Intronic
918829174 1:189370165-189370187 TCCTGAAAGGACATGGATTGAGG - Intergenic
921356412 1:214288397-214288419 TCCTTGAAGGTCATGGAGTCCGG - Intronic
922502152 1:226105118-226105140 TCCTGGAAGCTCCTGGAAGAGGG - Intergenic
923316801 1:232788415-232788437 CGCTGGAAGGTCATGGACCTTGG - Intergenic
923779994 1:237013704-237013726 TTCTGGAAGAACATGAAATTGGG - Intergenic
1063161927 10:3424505-3424527 TCCTGGAAGGTCATGAGGATGGG - Intergenic
1064318179 10:14277320-14277342 ACCTGCAAGGTGATGGTATTAGG + Intronic
1065457179 10:25919030-25919052 TCCAGGACTGTCCTGGAATTGGG + Intergenic
1065847675 10:29759615-29759637 TTCTGGAAGGACATGAATTTGGG + Intergenic
1069011805 10:63382483-63382505 TCATGAAAAGCCATGGAATTTGG - Intronic
1072418917 10:95273143-95273165 TCCAGGAAGGTCTTGTAATGTGG - Intronic
1073108939 10:101049405-101049427 TCCTGGGAGGTAAAGGAGTTCGG + Intergenic
1073656263 10:105420503-105420525 ACCTGGAAGTTCAGGGAATATGG + Intergenic
1074858809 10:117493637-117493659 TCCTGTAAGGTCCAGGGATTTGG - Intergenic
1076273773 10:129178953-129178975 TCCTGGAAGGACACGAATTTAGG + Intergenic
1076478419 10:130768200-130768222 CCTTGGAAGGTCATGGGCTTGGG + Intergenic
1080688828 11:34538449-34538471 CCCTGGAAGATAATGGGATTTGG - Intergenic
1081651685 11:44828038-44828060 TCCTGGGAGTTCATGGGCTTTGG + Intronic
1081671786 11:44946598-44946620 TCCTGGAGGTTCTTGGAAATGGG - Intronic
1083482690 11:62959839-62959861 TCATTGAAGGCCATGGAACTAGG + Intronic
1083490980 11:63014945-63014967 TCCGAGAAGGTCATGGCACTGGG + Exonic
1083981495 11:66174711-66174733 TCCTGGGAGGGAATGGAAATAGG + Intronic
1084348535 11:68575741-68575763 TCCTGAAAGTCCATGGGATTTGG + Intronic
1084934471 11:72579520-72579542 TCCCGGAAGGTGATGGGGTTGGG - Exonic
1087892959 11:103556113-103556135 TCCCGGAAGGTCAGGGAATGGGG - Intergenic
1088850367 11:113698976-113698998 TCCTGCAAGGTCCCGGAAATGGG + Exonic
1090584601 11:128197344-128197366 ACCTAGAAAGTCATGAAATTGGG - Intergenic
1092173141 12:6385533-6385555 TTCTGGAGGGACATGGAACTGGG + Intronic
1092342655 12:7689945-7689967 TCCTGGTAGAGCATGGAAATGGG + Exonic
1092487755 12:8916909-8916931 TCATGGAAGGTCATAAAACTAGG - Intronic
1096553703 12:52390629-52390651 TCCTGGCAGGGGCTGGAATTGGG - Intergenic
1096693273 12:53333942-53333964 TGCTGGAAAGACATGGGATTGGG - Intronic
1099842589 12:87984492-87984514 TCATGGAAGGACATGGGACTTGG - Intronic
1101107266 12:101453070-101453092 ACCTGGCAGGTCATGGAATTGGG + Intergenic
1101953551 12:109194799-109194821 TCCAGGAAGGCCATGAATTTTGG + Intronic
1102987234 12:117288218-117288240 TCCTGGAAGATCAAGAGATTTGG + Exonic
1106653342 13:31716082-31716104 TCCTGGAAAGTCTTCGTATTTGG - Intergenic
1108465048 13:50706918-50706940 TTCTGGAAGGTGCTGGAAGTTGG + Intronic
1109180839 13:59212432-59212454 TCAAGGAAGGACATGGATTTGGG - Intergenic
1109873297 13:68365355-68365377 TTCAAAAAGGTCATGGAATTTGG - Intergenic
1111826263 13:93271721-93271743 GCCTGGAATATCATAGAATTTGG + Intronic
1113628009 13:111860639-111860661 TCCTGGAGAGACATGGAAATTGG + Intergenic
1119395570 14:74323741-74323763 CACTGGAAGGTCAGGGAATCAGG + Intronic
1119876139 14:78061009-78061031 CCCTGCAAGGTGATGGTATTAGG + Intergenic
1119993301 14:79224607-79224629 TCCAGGAAGGACATGAATTTTGG - Intronic
1123150140 14:106173150-106173172 TCCTGGGAGCTCATTTAATTTGG - Intergenic
1123463366 15:20494657-20494679 TCCTGGAAGGACATGCACTGTGG + Intergenic
1123654694 15:22505754-22505776 TCCTGGAAGGACATGCACTGTGG - Intergenic
1124274208 15:28312065-28312087 TCCTGGAAGGACATGCACTGTGG + Intronic
1124308605 15:28600956-28600978 TCCTGGAAGGACATGCACTGTGG - Intergenic
1124845191 15:33283056-33283078 ACATGGAAAGTCATGGAAGTTGG + Intergenic
1126147093 15:45485294-45485316 TCCTGGAAGTTCATCTAAATGGG - Exonic
1130310480 15:82749542-82749564 TCCAGGAAGGACATGAATTTTGG - Intergenic
1130525724 15:84704682-84704704 TACTGGAAGGTTAAGAAATTTGG - Intronic
1132844851 16:1995737-1995759 CCATGGAAGGCCATGGAATAGGG - Intergenic
1134125622 16:11613966-11613988 TCCTGGCAGGTCCTGAGATTTGG + Intronic
1135407263 16:22207087-22207109 TCCTGGAGGTTCCGGGAATTCGG - Intronic
1138932212 16:61673490-61673512 TCATGGAATATCATGGAATTTGG - Intronic
1138983165 16:62295323-62295345 TCTTGGAAGGACATGAACTTTGG + Intergenic
1140067443 16:71623879-71623901 TTGTGGAAGGTCCTAGAATTTGG + Intergenic
1140407718 16:74722046-74722068 GCCTGGCAAGTCATGGACTTTGG - Intronic
1140985768 16:80156809-80156831 GACTGGAAGGCCATGGAATCAGG - Intergenic
1141800072 16:86301472-86301494 TCCTGGAATGTCATCTTATTAGG + Intergenic
1141848289 16:86626306-86626328 TCCAGGAAGGTCACTGACTTTGG - Intergenic
1143612071 17:8024537-8024559 TCCTGGAAGGTCATGTCACGTGG - Intergenic
1146605669 17:34255624-34255646 TCCTGGAAGGAGCTGGATTTGGG - Intronic
1146674081 17:34761042-34761064 CCATGTAAGGTCATGGGATTTGG - Intergenic
1148078785 17:44955944-44955966 TCCTGCAAAGTCATCCAATTAGG + Intergenic
1151405083 17:73881040-73881062 TTCTGGATGGTCATGAACTTAGG + Intergenic
1151619549 17:75237599-75237621 TCTTGGCAGGACATGGAATTTGG - Exonic
1151964522 17:77424516-77424538 ACCTTGAAGGTCAAGGTATTGGG - Intronic
1152155702 17:78631486-78631508 TCCTGGGGGGTGTTGGAATTGGG - Intergenic
1152988812 18:343605-343627 GCCTAGAAGGTCAGGGAGTTGGG - Intronic
1153518785 18:5932154-5932176 CCCTGGAAAGTCATGGAGATGGG + Intergenic
1155198904 18:23500763-23500785 TCCTCGATGTTCATGGAAATAGG + Intergenic
1155224552 18:23718151-23718173 TCCTGGTAGGGCATGGGCTTTGG + Intronic
1155727880 18:29112348-29112370 ACCTCCAAGGTCATGGTATTAGG - Intergenic
1155928199 18:31680097-31680119 TCATGGAGGGCCATGGTATTGGG - Intronic
1157308732 18:46535987-46536009 TTCTGGAAGGTGAAAGAATTAGG + Intronic
1157500709 18:48188675-48188697 TTCTGGAAGGTGATGGTGTTTGG - Intronic
1157635825 18:49153438-49153460 TCCAGGAGGATCATGAAATTTGG - Intronic
1160311010 18:77790121-77790143 TTTTGCAAAGTCATGGAATTGGG + Intergenic
1167659213 19:50786091-50786113 TCCTGAAAGTTCATGGCCTTGGG + Intergenic
925213628 2:2073128-2073150 ACCTGTAAGGTGATGGTATTAGG - Intronic
925506991 2:4577548-4577570 AGCTGGAAGGTCATGGATTTGGG - Intergenic
927051967 2:19338763-19338785 TCCTGGGAGCCCATGGATTTTGG + Intergenic
927693621 2:25225215-25225237 TCCTGGTAGGAGATGGAACTCGG - Intergenic
928320187 2:30277083-30277105 TCCTGCAAGGAGATGGCATTTGG + Intronic
929776222 2:44932715-44932737 TCCTGAAAGGTTAAGAAATTGGG - Intergenic
931518328 2:63067761-63067783 GTCTGGAAGGTGCTGGAATTAGG + Intergenic
932259796 2:70317573-70317595 TCCTGAAAGGACAAGGGATTAGG + Intergenic
935493204 2:103746261-103746283 TCCTGGGAGGTCAGGGGATGGGG - Intergenic
935837620 2:107072674-107072696 TGCTGGAAAGTCAGGGAAATAGG - Intergenic
936516670 2:113185474-113185496 TCCTGGGAGGATTTGGAATTTGG + Intronic
937336277 2:121064286-121064308 TCCTGGGAGTTCAAGGACTTTGG - Intergenic
937772152 2:125732105-125732127 ACCTACAAGGTAATGGAATTAGG - Intergenic
938906354 2:135840057-135840079 TCCTGGAAGACCATAAAATTTGG + Exonic
941919788 2:170839011-170839033 CCCTGGAAGATCATGAAATGTGG + Intronic
944632188 2:201638727-201638749 TCCAGGAATATCATGGAAATAGG + Intronic
947858164 2:233338516-233338538 TCCTAGAAGTTCATGTACTTGGG - Intronic
1169859905 20:10140595-10140617 TGCTGGAAGGTTCTGGAATTAGG - Intergenic
1170666962 20:18394719-18394741 TCCTTCAATGTCTTGGAATTAGG + Intronic
1171026222 20:21632834-21632856 TCCTGGGAGTTCATGCATTTGGG - Intergenic
1176043370 20:63079862-63079884 TCCGGGAAGCTCATCGATTTTGG - Intergenic
1176523067 21:7839197-7839219 TCCAGCAAGGGCATGGAACTAGG + Intergenic
1176528992 21:7943586-7943608 TCATGGAGTGTAATGGAATTGGG - Intergenic
1178035074 21:28571859-28571881 TTCTGGATGGTCATGGAAGTAGG + Intergenic
1178657087 21:34469209-34469231 TCCAGCAAGGGCATGGAACTAGG + Intergenic
1179022866 21:37656009-37656031 TCCTGGACCCTCATGGACTTAGG + Intronic
1181669529 22:24419692-24419714 TCCTGGCAGGTCATGGGGCTGGG + Intronic
1184111177 22:42396440-42396462 TCCTGGAAGAAGATGGGATTAGG + Intronic
1184904716 22:47473314-47473336 TCCTGCAAGTTCATGGTTTTCGG - Intronic
949843900 3:8351414-8351436 TCCTGGAAGATCATTGAATCTGG - Intergenic
951098564 3:18659891-18659913 TCACAGAAGGCCATGGAATTAGG + Intergenic
953262648 3:41354674-41354696 TCCTGGAAGATCAGGAAATGAGG + Intronic
953382758 3:42486532-42486554 TCCAGGAAAGTCCTGGAATGTGG - Intergenic
955183564 3:56693461-56693483 TCCTTGAACGTCATGTAAATGGG - Intergenic
955627484 3:60933973-60933995 TTGTGGAAGGGCATGGAATGGGG + Intronic
957035260 3:75288503-75288525 TCCTGGAGGGTCATGCATTTAGG + Intergenic
961079143 3:124010100-124010122 TCCTGGAGGGTCATGCATTTAGG + Intergenic
961304331 3:125946369-125946391 TCCTGGAGGGTCATGCATTTAGG - Intergenic
964385595 3:156144550-156144572 TCATGGTAGCTCATGGAATGAGG + Intronic
970128252 4:12838557-12838579 ACCTACAAGGTGATGGAATTAGG - Intergenic
970951836 4:21765538-21765560 CCCTGGAGGGACATGGAATCAGG + Intronic
970984565 4:22141170-22141192 TTCAGAAAGGTCAGGGAATTAGG - Intergenic
972928197 4:44038847-44038869 TCCTGGAATTTTCTGGAATTTGG + Intergenic
973203795 4:47536428-47536450 TTTTGAAAGGTCATGGAATCTGG + Exonic
973205261 4:47552577-47552599 ACCTGCAAGGTGATGGTATTAGG - Intronic
974407066 4:61486821-61486843 TCCTGGAAGATCATGGTTCTTGG + Intronic
974688936 4:65270289-65270311 TCCCCCAAGGTGATGGAATTGGG - Intergenic
975188231 4:71428516-71428538 CAATGGAAGGTCGTGGAATTGGG + Intronic
984181662 4:176490373-176490395 TCCCAGATGGACATGGAATTAGG + Intergenic
986288804 5:6381174-6381196 TCCTAACAGGTCATGGCATTTGG + Intergenic
987867737 5:23567876-23567898 TTCTGGAATGTCATGTAATAGGG + Intergenic
989149347 5:38283225-38283247 TTCTGGAAGGGCTTGGGATTTGG + Intronic
992518911 5:77527110-77527132 TGCTAGGAGGTCTTGGAATTTGG - Intronic
993019391 5:82573087-82573109 CCCTGGAAGGACATTGATTTGGG - Intergenic
996028396 5:118677730-118677752 TCCTGGAAGGTCAGGGTCCTAGG + Intergenic
997011817 5:129887489-129887511 TTTTGTAAGGTCATGAAATTTGG + Intergenic
997921047 5:137979729-137979751 TTATGGAAGGTCTTGGAATGAGG - Intronic
998256710 5:140594054-140594076 TACTGGGAGGTCATGGAAGGTGG - Intergenic
998443266 5:142179635-142179657 TCCTGGGAGGTCAGGGGTTTTGG + Intergenic
1000720001 5:164694057-164694079 TCCAGCAAGGGCATAGAATTGGG + Intergenic
1001863481 5:175081303-175081325 TCCTGGAAGGGCAGAGAAGTGGG - Intergenic
1002570114 5:180135435-180135457 TCCTGGAAGGAAATGGAACATGG - Intronic
1005753999 6:28909423-28909445 TCCTGGAAGGTCATGGAATTGGG - Intronic
1005854822 6:29852839-29852861 TCCTGGAAGGACATGGAGCCAGG - Intergenic
1007927502 6:45662332-45662354 ACCTGGAAGCTCAAGGGATTAGG + Intronic
1008482400 6:51999448-51999470 GCCTGGAAGGTGAAGAAATTTGG - Intronic
1008547569 6:52596890-52596912 TCCTGGCAAGGCATGGAATGGGG - Intergenic
1008835635 6:55824374-55824396 TTCTGGAAATTCATGGTATTTGG - Intronic
1010406594 6:75513037-75513059 TCTTGGAAGTTCAGGGATTTAGG - Intergenic
1012612883 6:101237189-101237211 TCATGGAAGGCCAAGGAATCTGG + Intergenic
1013665335 6:112341874-112341896 TCCATGAAGGTAAAGGAATTAGG + Intergenic
1014243045 6:119039545-119039567 TTCTAGAATGTCATGTAATTGGG - Intronic
1014659726 6:124154741-124154763 TCCAAGAAGGTCCTAGAATTTGG - Intronic
1014662906 6:124195210-124195232 TACTCTAAGGTCATGGAATATGG - Intronic
1015554332 6:134445350-134445372 GCCTGGAAGGGCATGGCAATGGG - Intergenic
1015707421 6:136103279-136103301 TCCTGTAAGATCATGGTACTCGG + Intronic
1016052779 6:139547759-139547781 TCCTGGACAGTAATGGAGTTGGG - Intergenic
1018942851 6:168320599-168320621 TTCTGGAAGTTCATGGAAATGGG + Intergenic
1019034605 6:169043670-169043692 ACCTTGAAGGTCATGGATATGGG + Intergenic
1021823066 7:24517131-24517153 CCATGGAAACTCATGGAATTAGG + Intergenic
1024780700 7:52845249-52845271 TCCGAGAAGGTCATAGAATCAGG - Intergenic
1029154252 7:98503704-98503726 TCCAGGAAGGACATGAATTTTGG - Intergenic
1034027812 7:147726087-147726109 TGGTGGAAGGGCATGGAATCAGG + Intronic
1034217648 7:149420694-149420716 TCTTGGAAGGACATGAACTTTGG - Intergenic
1035750363 8:1991887-1991909 TCCAGGAAGGTCAAGGTGTTTGG - Intronic
1036235760 8:7038110-7038132 TCCTTGAAGTTCCTAGAATTTGG + Intergenic
1037617717 8:20534407-20534429 TCCTGGAAGGGCCAAGAATTGGG + Intergenic
1037689662 8:21171359-21171381 GGCTGGTAGGTGATGGAATTAGG - Intergenic
1038125446 8:24668297-24668319 TCATGAAAGGTCATGGCACTTGG + Intergenic
1040416080 8:47197273-47197295 TCCTGGAAGATGCTGGAAATGGG - Intergenic
1040602387 8:48897479-48897501 TGCTGGCAGGCCATGGAAGTTGG - Intergenic
1041516360 8:58702981-58703003 ACCTGGAAGGTGATGGTATTAGG + Intergenic
1041527194 8:58820427-58820449 ACCTGGAAGGATATGGCATTTGG - Intronic
1043775367 8:84260701-84260723 TCCTAGTAGGTCATGGTAATAGG - Intronic
1044652967 8:94517554-94517576 TTCTGGAAAGTCATGAAAATTGG - Intronic
1044797811 8:95921954-95921976 CCCTAGAAAGGCATGGAATTGGG + Intergenic
1045172906 8:99690061-99690083 TTCTGTGAGGTCATAGAATTTGG + Intronic
1046291808 8:112172125-112172147 TACTGGCAGGACAAGGAATTGGG - Intergenic
1047404464 8:124573665-124573687 TGCTTGATGGTCCTGGAATTGGG - Intronic
1047462105 8:125076599-125076621 TCCTGAAAGGTGATGGGCTTTGG - Intronic
1047645262 8:126863426-126863448 TCCTGGAATCTGATGGAAATTGG + Intergenic
1047894760 8:129354216-129354238 TCCTGGAAGGTGGTGGCATGGGG - Intergenic
1048729427 8:137420987-137421009 TCCTGGATTGTAATGTAATTAGG + Intergenic
1049005243 8:139851277-139851299 TTCTGGAAGGACATTGACTTAGG - Intronic
1049672621 8:143876680-143876702 TCCTGGAGGGTCCTGGAACGAGG - Intronic
1050618469 9:7428388-7428410 TCCTGGATGGTCTTGATATTTGG + Intergenic
1051322442 9:15922225-15922247 TCCTGTCAAGACATGGAATTGGG - Intronic
1055556033 9:77474986-77475008 GACTGGGAGGTCATGGAAATAGG + Intronic
1055981127 9:82001862-82001884 TCCTGGAAGATCAGGGTAGTTGG + Intergenic
1056219304 9:84435608-84435630 TCCTCCAAGGTGATGGTATTAGG - Intergenic
1058873096 9:109219213-109219235 TTCTGGAATGTCATCCAATTAGG + Intronic
1058920030 9:109604620-109604642 TCCAGGAAAGCCATGGAGTTAGG - Intergenic
1059263993 9:113008859-113008881 TCCTGGAAGGTTAGGGGATGTGG + Intergenic
1059341587 9:113600524-113600546 TCCTGGAAGGACAAGGATCTGGG - Intergenic
1203387960 Un_KI270438v1:72086-72108 TCATGGAGTGTAATGGAATTGGG + Intergenic
1186610244 X:11131699-11131721 ACCCGGAAGGTGATGGTATTAGG - Intergenic
1188171018 X:26926613-26926635 TCCGGGATGGCTATGGAATTGGG - Intergenic
1194149717 X:90309218-90309240 TGCTAGAAGGACATGGGATTTGG - Intergenic
1195152934 X:102092286-102092308 TTCTGGAATGTCATATAATTGGG + Intergenic
1196617664 X:117786017-117786039 TAATGGTAGGTCATGGACTTAGG - Intergenic
1196791208 X:119467036-119467058 TCCTGGGGGGTCCTAGAATTGGG + Intergenic
1198270986 X:135055848-135055870 TGGTGGAATGACATGGAATTTGG + Intergenic
1199954786 X:152734425-152734447 TCCTGGAAGATAATGGAGTCCGG + Intronic
1200496095 Y:3885953-3885975 TGCTAGAAGGACATGGGATTTGG - Intergenic
1200684772 Y:6248270-6248292 TCCAGGACGTTCATGGCATTGGG + Intronic
1200990302 Y:9339535-9339557 TCCAGGACGTTCATGGCATTGGG + Intronic
1200992963 Y:9359850-9359872 TCCAGGACGTTCATGGCATTGGG + Intronic
1200995617 Y:9380128-9380150 TCCAGGACGTTCATGGCATTGGG + Intronic
1200998282 Y:9400474-9400496 TCCAGGACGTTCATGGCATTGGG + Intronic
1201000790 Y:9469006-9469028 TCCAGGACGTTCATGGCATTGGG + Intronic
1201003458 Y:9489338-9489360 TCCAGGACGTTCATGGCATTGGG + Intronic
1201006114 Y:9509620-9509642 TCCAGGACGTTCATGGCATTGGG + Intergenic
1201008772 Y:9529933-9529955 TCCAGGACGTTCATGGCATTGGG + Intronic