ID: 1005754869

View in Genome Browser
Species Human (GRCh38)
Location 6:28917203-28917225
Sequence GCAGATGGTCAGTCTCATCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 142
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 131}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1005754869 Original CRISPR GCAGATGGTCAGTCTCATCC AGG (reversed) Intronic
901591142 1:10344208-10344230 GCAATGGGTCAGCCTCATCCTGG - Intronic
903875176 1:26469127-26469149 GCAGGTGGCCAGCCTCATTCAGG - Exonic
906816537 1:48885944-48885966 GCAGTTGTCCACTCTCATCCAGG - Intronic
914926300 1:151891449-151891471 GCAGATGGTTGGATTCATCCAGG + Intronic
916574632 1:166056530-166056552 GTAAATGGTCAGATTCATCCAGG - Intergenic
917060973 1:171038988-171039010 GCTGATGGTCAGCTACATCCGGG - Intronic
919818164 1:201455139-201455161 GCAGATGGTCAGACTCTCCTGGG - Intergenic
1062903890 10:1166710-1166732 CCAGATGGTCAGGCTCAGGCTGG + Intergenic
1066435396 10:35392828-35392850 GGAGATGGTCATTGTCATCTGGG - Intronic
1067461473 10:46461579-46461601 GCAGATGCTCTGACTCCTCCAGG + Exonic
1067625721 10:47923022-47923044 GCAGATGCTCTGACTCCTCCAGG - Intergenic
1068991028 10:63150778-63150800 GCAGCTAGACAGTCTCATCTAGG + Intronic
1069862310 10:71479447-71479469 GCAGATGGACAGGCTCACCTTGG - Intronic
1069944407 10:71975997-71976019 GCAGATGGCCAGTTTCTTCCTGG + Intronic
1069953426 10:72035236-72035258 GCAGAAGGTCAGTGTCAGACAGG + Intergenic
1070168452 10:73914821-73914843 GCAGATGGTCTGTATAGTCCGGG - Exonic
1072686896 10:97542820-97542842 CCATATGGTCAGCCTCATGCAGG + Intronic
1073884958 10:108027712-108027734 GGAGTTGGTCAGTTTCATCTAGG - Intergenic
1074269048 10:111934874-111934896 ACAGATGGGAAGTCCCATCCAGG + Intergenic
1082761510 11:57131282-57131304 GCTCATGGTCAGCCTCAGCCTGG + Intergenic
1083785297 11:64941834-64941856 GGAGATGGTCAGTCACAGCAGGG + Intronic
1084858857 11:72005319-72005341 CCAGCTGCTCAGGCTCATCCTGG + Exonic
1085193766 11:74652895-74652917 ACAGATCATCATTCTCATCCGGG - Intronic
1085689802 11:78655723-78655745 CCAGTTGATCAGTCCCATCCTGG - Exonic
1086044846 11:82520806-82520828 GGAGATAGTCAGTCAGATCCAGG - Intergenic
1090323947 11:125868859-125868881 GGAGATGGTCAGGCTTCTCCTGG + Intergenic
1091297978 11:134487036-134487058 GGAGATGGTCACTCCCCTCCTGG + Intergenic
1091298057 11:134487344-134487366 GGAGATGGTCACTCCCCTCCTGG + Intergenic
1091298070 11:134487395-134487417 GGAGATGGTCACTCCCCTCCTGG + Intergenic
1091298122 11:134487601-134487623 GGAGATGGTCACTCCCCTCCTGG + Intergenic
1092946728 12:13463182-13463204 GCAGATGGACACTGCCATCCAGG - Intergenic
1096123638 12:49104600-49104622 GCAAATGGTCAGTCTCCTGTGGG - Intronic
1096215915 12:49797250-49797272 GCAAGGGGTCAGTCTCTTCCAGG + Exonic
1097131229 12:56811902-56811924 GCAGGTGGTGAGTATCAACCTGG - Intergenic
1097388992 12:58985925-58985947 GAAGACTGTCAGTATCATCCAGG - Intergenic
1101506820 12:105354766-105354788 GCAGATGGACGGATTCATCCAGG + Intronic
1103958778 12:124594483-124594505 GCAGATGTTCACCCTCATTCTGG + Intergenic
1107372255 13:39766042-39766064 GCAGCTGCTGAGTCTCAGCCAGG - Intronic
1108706327 13:52991775-52991797 CCACATGGTCAGTCCCAGCCAGG - Intergenic
1109999779 13:70180581-70180603 GCAGATGGTTAGGTTCATCTAGG - Intergenic
1113640253 13:111952247-111952269 GCAGCTGGTCAGTGTGATGCAGG + Intergenic
1117591828 14:57278051-57278073 CCAGTTGGTCAGTTTGATCCAGG + Intronic
1121216829 14:92254949-92254971 GCAGATGGAGAGACTCAGCCTGG - Intergenic
1121636832 14:95459551-95459573 GCAGATGGTCAGAACCCTCCTGG - Intronic
1122823176 14:104357190-104357212 GCAGAGGGTGAGTCTCCTCCAGG + Intergenic
1123062788 14:105601824-105601846 CCAGATGGCCAGGCTCATTCTGG + Intergenic
1132026377 15:98407589-98407611 GCAGATGGACCGTGTCATCCAGG + Intergenic
1132897536 16:2236198-2236220 GTAGACGGTCAGCCACATCCCGG - Exonic
1136776610 16:32875221-32875243 GCAGAGGGTGATTGTCATCCAGG + Intergenic
1136894005 16:33986292-33986314 GCAGAGGGTGATTGTCATCCAGG - Intergenic
1141497250 16:84418739-84418761 GCAGCTGTTCAGACTCTTCCTGG + Intronic
1142155166 16:88529686-88529708 GCAGGTGGTCTGGCACATCCAGG + Intronic
1203079025 16_KI270728v1_random:1137330-1137352 GCAGAGGGTGATTGTCATCCAGG + Intergenic
1144182108 17:12762192-12762214 GCAGATGATCAGGTTCCTCCAGG + Intronic
1147358087 17:39913079-39913101 GCAGAGTGTCACTCTCCTCCAGG - Intronic
1148978923 17:51554164-51554186 GCAGATGGCCATTCCCATCGTGG - Intergenic
1154930228 18:20986670-20986692 GCAGATGGTCAGTTTTTTCAGGG + Intronic
1157491479 18:48126863-48126885 GCAGATGGTCACTCTGACCTGGG - Intronic
1159881089 18:73859162-73859184 GCAGCTGTTCACTCCCATCCTGG - Intergenic
1161588913 19:5119846-5119868 GCAGAAGGTCAGTCCCTGCCGGG + Exonic
1162216566 19:9139337-9139359 ACAGATGGTTAGTATTATCCAGG - Intergenic
1163112588 19:15170464-15170486 GCTGCTGGTCATTCTCGTCCTGG - Exonic
1163156524 19:15442730-15442752 GCAGACGGGCAGCCCCATCCCGG - Intronic
1165797656 19:38528225-38528247 ACAGCTGGGCAGTTTCATCCAGG + Intronic
1168271684 19:55253410-55253432 GCAGATGGTTAGTCTGTACCAGG - Intronic
935305102 2:101730012-101730034 GAAGATGTTCCGTCTCATGCTGG - Intronic
936253429 2:110887072-110887094 GCAGATGGCCTGTCTCTGCCTGG + Intronic
937066847 2:119024008-119024030 GTAGCTGGTCAGCCTCTTCCAGG + Intergenic
938070323 2:128305006-128305028 GCACAGGGTCAGTGTCATGCAGG + Intronic
944503952 2:200390623-200390645 GCAGGTGGTCAGTGTGGTCCAGG + Intronic
944599114 2:201285192-201285214 GCAGAAAGTCAGCCTCATCCGGG - Exonic
944933789 2:204545995-204546017 GCACACGGTCACTTTCATCCTGG - Exonic
945816065 2:214606281-214606303 CCAGATGATCATTCTCACCCGGG - Intergenic
946265506 2:218537894-218537916 TCAGATGCTCTGTCTCTTCCAGG - Intronic
947929931 2:233956014-233956036 GCAACTGGACAGTCTCATCTGGG - Intronic
948062589 2:235052588-235052610 CCTGGTGGTCAGACTCATCCAGG + Exonic
948685579 2:239667690-239667712 GCAGATGAGAAGTCTGATCCTGG + Intergenic
1169099376 20:2932783-2932805 CCAGATGGTAAGTATAATCCAGG + Intronic
1169236156 20:3931500-3931522 GCAGATGCGCAGGCCCATCCTGG + Exonic
1169408807 20:5349368-5349390 GCAGGTGTTCAGTCTGAGCCTGG + Intergenic
1169689669 20:8316503-8316525 TCTGTTGGTCAGTCTCAACCCGG + Intronic
1171571518 20:26255777-26255799 GGAGAGGGTCACTCTCCTCCAGG + Intergenic
1173812351 20:45963790-45963812 GCAGAGTGTCATGCTCATCCGGG + Exonic
1178342833 21:31800729-31800751 GCAGAGGGGCAGCCTGATCCAGG - Intergenic
1179595001 21:42437555-42437577 GCAGACGGCCAAACTCATCCTGG + Exonic
1181683436 22:24512218-24512240 GCAGATGATAAGTCTGAGCCAGG + Intronic
1183267520 22:36838448-36838470 GCAACTGGTCAGGCTCCTCCTGG + Intergenic
950468046 3:13167134-13167156 GCAGATGGTCAGGAGCATCCTGG + Intergenic
951228986 3:20155005-20155027 GCAGCTGGTCAATCACATTCTGG - Intergenic
952210294 3:31223305-31223327 GCAGTTAGGCAGTCTCATCTGGG + Intergenic
953536942 3:43783839-43783861 CCAGATGGTCAGTTTCAGCTTGG + Intergenic
956770384 3:72520945-72520967 GCAGATGATCACTTTCTTCCTGG + Intergenic
964100043 3:152978238-152978260 GCAGATGTTAAGTCTGATCTAGG - Intergenic
964441609 3:156717186-156717208 GCAGATGTTCAATCTCTTACTGG + Intergenic
967281279 3:187826535-187826557 GTAGATGGGCAGACACATCCTGG + Intergenic
968230041 3:197000128-197000150 GCAGACTCTCAGTCTCATGCTGG + Intronic
970491568 4:16580443-16580465 TCATATTGTCAGTCTCATCTGGG - Intronic
970513795 4:16807044-16807066 GGAGCTGATCAGTCCCATCCTGG + Intronic
975197043 4:71537829-71537851 TCAGATGGTCATTCTAATTCAGG + Intronic
981038647 4:140198594-140198616 GGAGATTGCCAGTCTCTTCCCGG - Intergenic
981459256 4:144992981-144993003 GCAGGTGGAGAGTCTCATCTAGG - Intronic
992457922 5:76933209-76933231 GGAGATGGGAAGCCTCATCCGGG - Intergenic
994174845 5:96700518-96700540 GCAGAATCTCAGCCTCATCCTGG - Intronic
996546850 5:124688505-124688527 TGAGATGGGCAGTCTCATCCAGG + Intronic
997090859 5:130855920-130855942 ACAGTTGGTCACTCTCATCAGGG - Intergenic
998794117 5:145799458-145799480 GGAGATGGTCTCTCTCCTCCAGG + Intronic
1001603384 5:172943591-172943613 GCAGCTGGACAGTGTCATCCCGG + Intronic
1002841804 6:912864-912886 GCAGTAGGTCACACTCATCCTGG + Intergenic
1005463761 6:26092372-26092394 ACAGATGGTCAGTTTCACCTGGG - Intronic
1005754869 6:28917203-28917225 GCAGATGGTCAGTCTCATCCAGG - Intronic
1006924436 6:37646816-37646838 GGGGAGGGTAAGTCTCATCCAGG - Intronic
1009334660 6:62472271-62472293 GCTGATTGTCAGTCTCAGCCTGG + Intergenic
1009555071 6:65152517-65152539 GCAGATGGTCACCCTCTTTCTGG - Intronic
1010654193 6:78492519-78492541 GCAGCTGGTCACTGACATCCAGG + Intergenic
1011521914 6:88216943-88216965 GCAGATGGCCACTCTCTTGCTGG + Intergenic
1015598719 6:134891888-134891910 GCAGAAGGTCAGTCTCCTGAAGG + Intergenic
1019340503 7:506790-506812 GCTGCCGGTCAGTCACATCCTGG + Intronic
1020516670 7:9130181-9130203 GCAGATTGGAAGTCTCATGCAGG + Intergenic
1020975692 7:15003365-15003387 ACAGATTCTCAGTCTCATCTTGG - Intergenic
1021767476 7:23964320-23964342 GCAGATGGTCAACTTCCTCCTGG + Intergenic
1022132089 7:27414243-27414265 GGAGATGGTCTGTCTCCTCCTGG + Intergenic
1022151563 7:27612919-27612941 GGAGATGGTCTCTGTCATCCAGG - Intronic
1022277653 7:28871684-28871706 GCAGATGGGGAGTGTCAGCCTGG - Intergenic
1024303773 7:47908966-47908988 GCCAAGGGTCAGTCTCCTCCAGG + Intronic
1028067589 7:86406570-86406592 GCAGCTAGTCAGTTTCATCTGGG - Intergenic
1033434538 7:141321140-141321162 CCAGATGCTAAGTCTCACCCAGG - Intronic
1033435757 7:141332051-141332073 GAAGATGGACAGTCACAACCAGG - Intronic
1039510708 8:38089862-38089884 GGAGATGGCCAACCTCATCCTGG + Intergenic
1041381495 8:57258325-57258347 CCAGATGCTCAGCCTCATCCTGG + Intergenic
1042153707 8:65818745-65818767 GCACATGCACAGCCTCATCCAGG + Intronic
1044410592 8:91878247-91878269 CAAGATGGTCAGTGTCCTCCTGG - Intergenic
1048417274 8:134241451-134241473 GCAGATGATCAGTGTGATCTTGG + Intergenic
1049127817 8:140808270-140808292 GCAGAGGGTTGGTCTCATTCAGG + Intronic
1057706961 9:97401601-97401623 GCAGATGCTCAGTTTTATTCAGG - Intergenic
1060604967 9:124905434-124905456 GCAGAGTCTCACTCTCATCCAGG - Intronic
1061392920 9:130327673-130327695 TCAGATGGGGAGTCTCACCCTGG - Intronic
1185785047 X:2883799-2883821 GCAACTGGACAGTCCCATCCAGG + Intergenic
1186287611 X:8062606-8062628 GCAACTGGACAGTCTCATCTGGG - Intergenic
1198466045 X:136905760-136905782 GCAACTGGTCAATCTCTTCCAGG + Intergenic
1198514312 X:137389368-137389390 GCAGAATGTCAGTCTCAGCAAGG + Intergenic
1199038690 X:143084272-143084294 GCAGAAGGTCAGATTCTTCCAGG + Intergenic
1200103251 X:153698819-153698841 GCAGAGGGTGATTGTCATCCAGG - Intergenic