ID: 1005755219

View in Genome Browser
Species Human (GRCh38)
Location 6:28920078-28920100
Sequence GGAGATGTTGCAAGAGAACT GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 266
Summary {0: 1, 1: 0, 2: 2, 3: 19, 4: 244}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1005755219 Original CRISPR GGAGATGTTGCAAGAGAACT GGG Exonic
901441529 1:9281242-9281264 GCAGATGTAGCGAGAGCACTTGG + Intergenic
901444022 1:9296040-9296062 GGAGATGTTATCAGATAACTGGG - Intronic
903030285 1:20459147-20459169 GGAGATGGAGCAAAAGAAATTGG + Intergenic
903785581 1:25859176-25859198 GGAGATGATGAAAGCGAAGTCGG - Intronic
903793578 1:25911320-25911342 GGAGTGGTTGGTAGAGAACTTGG - Intergenic
903807614 1:26016770-26016792 GGAGATGCAGCAAGAGAAACAGG + Intergenic
904431802 1:30469110-30469132 GGATATGGTGGAAGAGGACTCGG + Intergenic
904871048 1:33618482-33618504 GGTGATCTTGAAAGAGGACTAGG - Intronic
906121468 1:43394944-43394966 GGGGATGTTGCAAGAAGACTAGG + Intronic
906958617 1:50399094-50399116 GGTGATGTTGCAAAGAAACTGGG - Intergenic
907018710 1:51043491-51043513 GGATATTTTGCAAGACAACTGGG + Intergenic
907956071 1:59229553-59229575 GGAGATGGTGTCACAGAACTTGG - Intergenic
908499401 1:64728137-64728159 GAAGAGCTGGCAAGAGAACTGGG + Intergenic
910360192 1:86408454-86408476 GGAGATTATTCAAGAAAACTGGG + Intergenic
910608939 1:89118939-89118961 GGAGATGTTGCACCAGAAGCTGG + Intronic
913492750 1:119396846-119396868 GCAGATGTTGCTAGAATACTTGG + Intergenic
915036577 1:152932655-152932677 TGAGATGTAGCAAGAGGACCAGG + Intergenic
915755498 1:158255739-158255761 GGACCTGGTGTAAGAGAACTGGG - Intronic
916793863 1:168147551-168147573 AGAGGTGTTGGAAGAGAACCAGG - Intergenic
917077255 1:171218412-171218434 TGAGAAGTGGCAAGTGAACTGGG - Intergenic
917660368 1:177171628-177171650 GGAGATGTTGCACAAAAACCTGG + Exonic
918384511 1:183992097-183992119 TGAGATGTTGCTAGAGTTCTAGG - Intronic
919222799 1:194652741-194652763 GGAGAAGTGGCAAGAAAAGTGGG + Intergenic
922114527 1:222599075-222599097 GCAGAAGTTCCAAGAGAGCTTGG + Intergenic
922967699 1:229705474-229705496 GGTGATGTTGCAAAGAAACTGGG - Intergenic
923152998 1:231251498-231251520 AGAGATGTTGCAGGTGAAGTGGG + Intronic
923784672 1:237055455-237055477 GGAGCTGGTGCAAGATAATTCGG + Intronic
924168720 1:241313911-241313933 GTAGAAATAGCAAGAGAACTTGG + Intronic
924431988 1:244005074-244005096 GGAGATGTTGTTACAGAACTGGG + Intergenic
1064715326 10:18171130-18171152 GGAGATTTTGCAAGTGGAATTGG + Intronic
1065550935 10:26867872-26867894 GGAGATGTTGGAAGAGATGTTGG - Intergenic
1065693745 10:28360361-28360383 AGAGATATTGCAAGAGTACAAGG - Intergenic
1065806743 10:29399983-29400005 GGAGATGCTGTTATAGAACTGGG - Intergenic
1066286910 10:33976575-33976597 GGATATGTTCTAAGAGAAATGGG + Intergenic
1069754072 10:70762519-70762541 TGGGCTGTAGCAAGAGAACTGGG + Intergenic
1070639286 10:78155012-78155034 GGAGATGTTGCTACAGAACTGGG - Intergenic
1071009870 10:80925445-80925467 GGTGCTGTGGAAAGAGAACTGGG + Intergenic
1071235582 10:83644329-83644351 GGAGATGTTGCTATTGAATTTGG - Intergenic
1071466783 10:85947876-85947898 GGATATGTTGCAAAAGAATTAGG + Intronic
1073994602 10:109301157-109301179 GGAGATGAGGCAAGAGAATAGGG - Intergenic
1076283263 10:129269312-129269334 CCAGATTTTGCAAGAGAATTAGG + Intergenic
1077606143 11:3614046-3614068 GGAGTTGTTGTATGACAACTAGG + Intergenic
1078470770 11:11584420-11584442 GGAGATGCCGTAAGAGAAATGGG + Intronic
1078736170 11:14023114-14023136 GGAGATGATGCCTGAGAAGTTGG + Intronic
1078856605 11:15210443-15210465 GGAGTTGTTAGAAGAGAGCTGGG + Intronic
1079947865 11:26766065-26766087 GTTGAGGTTGCAAGATAACTTGG - Intergenic
1081085456 11:38794805-38794827 GGACAATTTCCAAGAGAACTAGG + Intergenic
1083135673 11:60673783-60673805 AGAGATGTTGGGAGAGAAATAGG - Intergenic
1084160527 11:67346820-67346842 AGAGATGTTGCAAAAGAAGTTGG - Intronic
1086160807 11:83719777-83719799 GGAGGTGTTCCAAAAGAATTTGG + Intronic
1087129626 11:94657036-94657058 GGAGATGAGGCAAGAGAATAGGG + Intergenic
1089949862 11:122515601-122515623 GGAGGTGGTTCAAGAAAACTTGG + Intergenic
1091414968 12:274633-274655 GGAGATGTTTTAAAATAACTTGG + Intergenic
1091561604 12:1618533-1618555 GGAATTGTTTCAAGAGAACAAGG - Intronic
1095878269 12:47105257-47105279 GGAGATGTTTCAAGTGAAGAGGG + Intronic
1097318995 12:58204844-58204866 GGAGTTGTTGCAAGATCAGTAGG + Intergenic
1099122620 12:78710739-78710761 GGAGCAGGAGCAAGAGAACTTGG - Intergenic
1099150981 12:79113686-79113708 GGAAATTTTGCCAGAGAACAAGG + Intronic
1101440209 12:104698251-104698273 GGAGATGATGCTGGAGAAATGGG - Intronic
1101746974 12:107549891-107549913 GGAGTTGTTACAAGAGATATTGG + Intronic
1104287169 12:127433901-127433923 GGGGACGTTGGAAGGGAACTTGG - Intergenic
1106196164 13:27495938-27495960 GGAGCTGGTGGATGAGAACTTGG + Intergenic
1106939954 13:34767493-34767515 GGTGATGTTGAAAGAGCAGTGGG - Intergenic
1108916908 13:55625059-55625081 GCAGAAATAGCAAGAGAACTAGG + Intergenic
1109339982 13:61043794-61043816 GGAGAAGATGCAAGAGATCATGG - Intergenic
1109566467 13:64121678-64121700 GGAGATGTTACAACTGAACGTGG - Intergenic
1110735622 13:78932963-78932985 GTAGAAATAGCAAGAGAACTAGG + Intergenic
1111206404 13:85017265-85017287 TGAGTTGATGCAAGAAAACTGGG - Intergenic
1112400212 13:99070739-99070761 GGATATAGTGCATGAGAACTTGG - Intronic
1113313548 13:109155612-109155634 GGAGATCTGGGAAGAGAACTGGG - Intronic
1117097059 14:52309714-52309736 GGAAATATTGCATGAGATCTGGG + Intergenic
1117580106 14:57143417-57143439 GGAGATGCTACTACAGAACTGGG - Intergenic
1117688934 14:58285123-58285145 GGTGATGTTGCAAAGAAACTGGG + Intronic
1119491419 14:75037137-75037159 GGAGATGAGGCTAGAGAAGTAGG - Intronic
1120806174 14:88753198-88753220 TGAGAGGTTGCAGGAGAGCTGGG - Intronic
1120840382 14:89080380-89080402 GGAGCTGAGGCAGGAGAACTGGG + Intergenic
1123051065 14:105542837-105542859 GGAGCTGTTGCAAGAGATACAGG + Intergenic
1127397031 15:58551173-58551195 GGAGGGGCTGCAGGAGAACTGGG - Intronic
1127787266 15:62366557-62366579 GGATATGTTGGAAAAGGACTAGG + Intergenic
1128904615 15:71455762-71455784 GTAGATGCTGAAAGAGAAGTGGG + Intronic
1129238722 15:74239428-74239450 GCAGATGTTGCAGGGGAACTAGG - Intronic
1129335624 15:74850609-74850631 GGAGCTGTTGCCCGAGAACCAGG + Exonic
1129386488 15:75199024-75199046 GGTGATGTTGCAGGAGAATAAGG - Exonic
1129912061 15:79236064-79236086 GGAGATGTGACCAGGGAACTTGG + Intergenic
1132984941 16:2760629-2760651 GCAGATGCAGTAAGAGAACTAGG - Intronic
1134856434 16:17523745-17523767 GAAGAGGCTGGAAGAGAACTTGG + Intergenic
1135647229 16:24173696-24173718 AAAGAGGTTTCAAGAGAACTGGG - Intronic
1137464359 16:48694773-48694795 GGAGATCTTTAAAAAGAACTGGG - Intergenic
1138851674 16:60636719-60636741 GGAGAGGTTTCAAGAGTTCTTGG - Intergenic
1140290218 16:73646963-73646985 GGAGATGTTTCAGGCGAATTAGG + Intergenic
1141835845 16:86538748-86538770 GGAGATGGTACCAGAGACCTGGG - Intronic
1143575791 17:7792392-7792414 GGGGATGTGGCAAGAGAGATGGG + Intronic
1143901714 17:10179403-10179425 GGAGATATTTCAGGAGATCTTGG + Intronic
1145011381 17:19370284-19370306 GGAGATGTCGTAGGACAACTGGG + Intronic
1146979197 17:37143908-37143930 GGTGATGTTGCAAAGAAACTGGG - Intronic
1147510396 17:41064112-41064134 GAAGATGTTACAGGAGAGCTAGG - Intergenic
1148612901 17:48976600-48976622 GCAGAGGTTGCAAGTGAACTGGG - Intergenic
1148793160 17:50184897-50184919 GGAGATGTTGCAAGAGCCATGGG + Exonic
1149414106 17:56440519-56440541 GCAGTTGTTGCCAGAGGACTGGG - Intronic
1150108843 17:62479828-62479850 GGAAGTGTTGCGAGAGACCTTGG + Intronic
1150189656 17:63224632-63224654 GGAGATGTTATCATAGAACTGGG - Intronic
1150668773 17:67171119-67171141 GGAGAGGTAGGAAGAAAACTAGG - Intronic
1155561595 18:27083711-27083733 GCAGATGTTCCAAGAGTTCTAGG - Intronic
1155816824 18:30322197-30322219 GGAGAAGTTTCAATAAAACTTGG - Intergenic
1156055250 18:32994322-32994344 AGAGATGTAGAAAGAAAACTGGG + Intronic
1158100022 18:53819909-53819931 GGAGTTGTTGCCAGAGGACCAGG + Intergenic
1158747163 18:60214422-60214444 GGAAGTGTTGAAAGAGAACATGG + Intergenic
1159142956 18:64419323-64419345 GGTGATGTTGCAAGACTGCTTGG + Intergenic
1159746290 18:72239795-72239817 AGAGATGTGTCCAGAGAACTCGG + Intergenic
1160078617 18:75702577-75702599 GGGGAGGCTGCAAGAGGACTGGG + Intergenic
1168361476 19:55744448-55744470 GGAGATTGTGCCAGAGACCTTGG - Intergenic
927968927 2:27291816-27291838 GGAGATATGGCAGGAGAAATTGG + Intronic
930822427 2:55660274-55660296 GGGGATTTTACAAAAGAACTAGG + Intronic
930977861 2:57486348-57486370 GGAGAAGTGGAAAGAGAAATAGG - Intergenic
931240917 2:60452003-60452025 GGAGATGTAGGAGGGGAACTAGG - Intronic
931615059 2:64147131-64147153 TGGGAAGTAGCAAGAGAACTAGG + Intergenic
932018589 2:68059151-68059173 GGAGAAGTGGCAAGAGAAAGAGG + Intronic
932549978 2:72758722-72758744 AGAGATGTTCCAGCAGAACTTGG - Intronic
933580610 2:84122491-84122513 GCAGAAGTTGCAATTGAACTAGG - Intergenic
935014112 2:99163764-99163786 GGAGAGGTGGCAAGAAATCTGGG - Intronic
935132213 2:100269105-100269127 GGAGAGGCTGCTACAGAACTCGG - Intergenic
935812824 2:106816930-106816952 GGAGACTTTGCAATGGAACTCGG + Intronic
936530527 2:113273426-113273448 GGAAATGTACCAAGAGAAGTGGG + Intronic
938340956 2:130536222-130536244 GGAAATGTAGAAAGAGAACGGGG - Intergenic
938348874 2:130584487-130584509 GGAAATGTAGAAAGAGAACGGGG + Intergenic
938387851 2:130880432-130880454 GGAGATGTGGAAGGAGACCTGGG + Intronic
939714005 2:145559927-145559949 CGAGATGTGGCTAGAAAACTAGG + Intergenic
940154257 2:150637232-150637254 GGAGATGTGGTAAGAGAGATAGG - Intergenic
941872051 2:170396232-170396254 GGAGATGAAGCAAGAGAAAATGG + Intronic
944323370 2:198375518-198375540 GGAGAGGCTGCAGGAGAAGTGGG - Intronic
944444267 2:199773891-199773913 GGACCTGCTGCTAGAGAACTGGG - Intronic
947059355 2:226145262-226145284 GGAGCTGTTGGAAGATAACCAGG + Intergenic
1169587123 20:7097256-7097278 GGAGTTGTTACAACAGGACTTGG + Intergenic
1169750622 20:8989572-8989594 GTAGAAATAGCAAGAGAACTAGG - Intergenic
1170313767 20:15020138-15020160 GGAGATTTTGCAGCAGAAGTAGG - Intronic
1171456469 20:25275408-25275430 GGAGAGGCTGCAGGAGAACGTGG + Intronic
1172788384 20:37485602-37485624 TGAGATGTTGCAAGAGAAGAAGG + Intergenic
1174853927 20:54024674-54024696 GGAGATGATGGAAGAGTACCAGG + Intronic
1180928770 22:19574504-19574526 GGAGATTTTGCAAAGCAACTTGG + Intergenic
1181137617 22:20779704-20779726 GTAGAGGTTGAAAGCGAACTTGG - Exonic
1183119458 22:35719179-35719201 AGTTATGTTGCAGGAGAACTAGG + Intronic
1184274865 22:43404437-43404459 GGAGACAATGCAGGAGAACTTGG - Intergenic
949201621 3:1387375-1387397 GAAGTTGTTGCCAGATAACTTGG + Intronic
949229641 3:1735444-1735466 GGAGATGTTGTTAGAATACTTGG - Intergenic
950112521 3:10428566-10428588 GGAGATGTTGCTAGGCAACCAGG - Intronic
950901795 3:16504778-16504800 GGAGATGTTGAAACAGTTCTTGG - Intronic
952615343 3:35264491-35264513 GGTGAAGCTGCTAGAGAACTTGG - Intergenic
953316842 3:41935874-41935896 GAAGATGTTGTGAGAGAATTTGG - Exonic
955484188 3:59419115-59419137 TAACATGTTTCAAGAGAACTTGG - Intergenic
957518957 3:81294383-81294405 TGACATGTTGCAGGAGAAATTGG - Intergenic
958785489 3:98593186-98593208 GGAGATGTTGCCTAAGACCTCGG - Exonic
960493907 3:118352619-118352641 GGAGATGTAGGAAGAGCAATAGG + Intergenic
960765807 3:121128546-121128568 GGAGTTGATGCAAGAGAGCCAGG + Intronic
961127642 3:124434757-124434779 GGAGGTGTTGAAATAGAAATTGG + Intronic
961375564 3:126463169-126463191 GGAGCTGAGGCAAGAGAACGGGG - Intronic
961540062 3:127593303-127593325 GGAGATGCTGCTACAGAACTGGG + Intronic
962294585 3:134170852-134170874 GGAGATGTGGCAAAAAAGCTAGG + Intronic
962590330 3:136883289-136883311 AGAGATGTGGCCAGAGAACAAGG - Intronic
964908290 3:161745413-161745435 GGTAATGCTGAAAGAGAACTGGG + Intergenic
964937255 3:162105337-162105359 GGAGTTGCTACAAGAGGACTAGG - Intergenic
964966047 3:162495224-162495246 GGAGAAGTGGCTAGAGAAGTGGG + Intergenic
965727383 3:171732537-171732559 GGAGAGGATGCAAGAGCATTTGG - Intronic
967419877 3:189261075-189261097 GGAGATGTTGCTGGAGCAATAGG - Intronic
967594231 3:191311630-191311652 GAAGATGCTGCTACAGAACTAGG - Intronic
967671243 3:192238217-192238239 AGTGTTGTTGCAAGTGAACTGGG - Intronic
971432625 4:26584190-26584212 GGAAATGTTGCAGGAGGAGTCGG + Exonic
972394107 4:38643344-38643366 GGAGGAGATGGAAGAGAACTGGG + Intergenic
972414096 4:38821667-38821689 GGAGATGTTGGGAGACAATTAGG + Intronic
972725120 4:41740544-41740566 GGAGATTTTGCAAGAGACTCCGG - Intergenic
975240856 4:72057384-72057406 GGAGATCTTTCAAGGCAACTTGG - Intronic
975266683 4:72377369-72377391 TAAGATGTTCCAAGAGAAATAGG + Intronic
976095687 4:81506313-81506335 GGATACATTGCAACAGAACTGGG - Intronic
976473867 4:85460451-85460473 GGAGAAGTTGGAAGAGAACATGG + Intergenic
976567302 4:86565960-86565982 GGAGAAGTTACAAGAGACTTGGG - Intronic
977209002 4:94196144-94196166 GGAGATGTGGCAAAAAAGCTGGG - Intergenic
977400569 4:96525969-96525991 TGAGAAGTTACAAGAGTACTAGG + Intergenic
979275573 4:118811351-118811373 GCAGATGATGCAAGAGAAAGGGG + Intronic
979562682 4:122118150-122118172 GCAGATGCTGCAACAGAGCTTGG - Intergenic
981677046 4:147354264-147354286 GCTGATGTTCCAAGAGAAATAGG - Intergenic
982176952 4:152714943-152714965 GGAGCTGTTGCAAGAGATGGGGG + Intronic
982302465 4:153893702-153893724 GGTGTTGTTGAAAGGGAACTTGG - Intergenic
982876131 4:160652571-160652593 GTAGAAATAGCAAGAGAACTAGG + Intergenic
983344319 4:166507143-166507165 GTAGATGATGTTAGAGAACTTGG + Intergenic
984295715 4:177852335-177852357 GGAAATATTGCAACAGCACTTGG - Intronic
984624423 4:181989534-181989556 GGAGATGTTGTAAGTGGACTGGG - Intergenic
985150094 4:186938033-186938055 GGAGATGTTACAAGAAAATAAGG + Intergenic
985772962 5:1824592-1824614 GGGGATGCTGCAAGTGCACTGGG - Intergenic
987847201 5:23302191-23302213 GTAGAAGTTGCTAGTGAACTTGG - Intergenic
988598845 5:32620854-32620876 GCAGATGTTGAAAGAGAAGTGGG - Intergenic
988695091 5:33613813-33613835 GGAGATGGAGAAAGAGCACTGGG + Intronic
991219764 5:64199681-64199703 GGAAATGTGGCCAGGGAACTAGG + Intronic
991641897 5:68762671-68762693 GGAACTGTTGCAAAAAAACTTGG + Intergenic
993124228 5:83812622-83812644 GTAGAAATAGCAAGAGAACTAGG - Intergenic
993982998 5:94565236-94565258 GGTGATGTTGCAAAAAAACAGGG - Intronic
995678179 5:114686615-114686637 GCATTGGTTGCAAGAGAACTTGG - Intergenic
996842645 5:127864791-127864813 TGTGATGTTGCAAGTGAATTGGG - Intergenic
998293705 5:140943753-140943775 GGAGATGTAGGAAAAAAACTAGG + Intronic
999222891 5:149996236-149996258 GGTGATGTGGCAAAAGAATTTGG - Exonic
1002214359 5:177619342-177619364 GAGGATGTTCCATGAGAACTTGG - Intergenic
1002504321 5:179668509-179668531 GGAGATGCTGCCATGGAACTTGG - Intergenic
1002508107 5:179694542-179694564 GGAGATGTGGCAAAAAAGCTGGG + Intronic
1002855004 6:1028596-1028618 GGAGGAGTTGCTAGAGAATTGGG + Intergenic
1003832830 6:10033369-10033391 GGAGCTGTTGCAAGAGTTCCTGG + Intronic
1003974823 6:11332495-11332517 TGTGGTGTTACAAGAGAACTTGG - Intronic
1005755219 6:28920078-28920100 GGAGATGTTGCAAGAGAACTGGG + Exonic
1006058375 6:31402396-31402418 GGAGATGTCACCAGAGAAATGGG + Intronic
1007419044 6:41708285-41708307 GGAGATGTGGGAAGAGGGCTTGG + Intronic
1007731648 6:43951207-43951229 GGAGAGGTTGCTGGAGAGCTGGG - Intergenic
1007923355 6:45630487-45630509 GCATATGTGGCAAGAGAGCTCGG + Intronic
1009505895 6:64477698-64477720 GGAAATGTTACAAGATAAATAGG + Intronic
1009961317 6:70525410-70525432 GGATGTGTCGCAAAAGAACTCGG - Exonic
1010404264 6:75484828-75484850 GCAGATGTGCAAAGAGAACTAGG + Intronic
1011954617 6:93011305-93011327 GGAGATTTTGATAGATAACTGGG - Intergenic
1017717479 6:157222775-157222797 GGAAAAGGAGCAAGAGAACTGGG - Intergenic
1017887382 6:158610316-158610338 GGAGCTGTTGAAAGAGAATCTGG - Intronic
1019028072 6:168988549-168988571 GGAGATGGGGCAAGAGACTTGGG + Intergenic
1019333612 7:472273-472295 GGAGCTGTTGCAAGTGAGCTGGG - Intergenic
1020203337 7:6097127-6097149 GGAGATGCTGTTACAGAACTGGG - Intergenic
1021012821 7:15492826-15492848 GGAGAGGTTGCAAAAGGACTAGG - Intronic
1024382060 7:48708401-48708423 GGAGAGATTGGAACAGAACTTGG + Intergenic
1024957993 7:54946119-54946141 AGAGTTGATTCAAGAGAACTTGG + Intergenic
1027606343 7:80304403-80304425 GGAGATGCTGCAAGATTTCTAGG - Intergenic
1027967998 7:85038691-85038713 GGAAAGGTGCCAAGAGAACTAGG + Intronic
1028676876 7:93474732-93474754 GGAGATTTTGCAAGTGTATTTGG + Intronic
1029409711 7:100401084-100401106 GAAGATGTTGGGAGAGAGCTGGG - Exonic
1030902956 7:115147725-115147747 TGCTATGTTGCAAGAGAATTGGG - Intergenic
1031238810 7:119211825-119211847 GGAGATGTGCCAAGTGAAGTGGG - Intergenic
1032340400 7:131067135-131067157 GGAGATGTTGTCAGAGATCAGGG + Intergenic
1032625936 7:133591132-133591154 GGAGATGCTGCAATTGAAATAGG - Intronic
1033481131 7:141741893-141741915 GGAGATGTCGCAAAATAAATGGG + Intronic
1033877701 7:145842696-145842718 GGAGATGTTGAACAGGAACTAGG + Intergenic
1038414950 8:27388325-27388347 GGAGAAGTTGGAGGATAACTTGG + Intronic
1038422492 8:27442450-27442472 GGGGATGTTTCATGAGAAATAGG + Intronic
1039966286 8:42286531-42286553 GCAGAGGTTGCAGGAGATCTGGG - Intronic
1040288971 8:46114619-46114641 GCAGATGCTGCAAGACCACTGGG - Intergenic
1040291924 8:46129907-46129929 GGAGATGTGGCAAGACCACAGGG - Intergenic
1042195096 8:66225121-66225143 GGAGATGGAGGAACAGAACTGGG - Intergenic
1043279037 8:78439502-78439524 GGGGATGTGGCAGGACAACTGGG - Intergenic
1043500442 8:80849176-80849198 TGAGATGTTGCAGTAGAATTTGG - Intronic
1044701481 8:94969052-94969074 GAAGATGTTGCAGAAGAAGTTGG + Intronic
1045916408 8:107476907-107476929 GGAGAAGCAGCTAGAGAACTAGG - Intronic
1046077994 8:109334903-109334925 GGAGAAGTTGAGTGAGAACTAGG - Intronic
1046437988 8:114218986-114219008 GTAGATGTTGAAATACAACTTGG - Intergenic
1047855480 8:128905379-128905401 GGAGGTGTTCCAATAGAAATTGG - Intergenic
1048253530 8:132887137-132887159 GAAGATGTGGCAAGAGATTTAGG + Exonic
1048838919 8:138547546-138547568 GGAGAAGGTGAAAGAGAAGTGGG - Intergenic
1049519198 8:143079689-143079711 GCAGATGCTGCAAAAGAAATTGG + Intergenic
1050712720 9:8483954-8483976 GGACACGTTGTAAAAGAACTCGG + Intronic
1050958941 9:11702931-11702953 GAACATGCTGCAACAGAACTAGG - Intergenic
1051083555 9:13320993-13321015 GGAAATGTTCCAAGAGATCTGGG + Intergenic
1055062090 9:72079656-72079678 GGAGATGTTGCAAGCAAAGGAGG - Intergenic
1055478691 9:76688673-76688695 GGCAATGATGCAAGAGAAATGGG - Intronic
1058201976 9:102055058-102055080 GAAGGTGTTTCAAGAGAAATGGG + Intergenic
1058359963 9:104133530-104133552 GGAGATTTCTCTAGAGAACTTGG + Intronic
1060190899 9:121591895-121591917 GGAGAAGTGACCAGAGAACTAGG + Intronic
1061129011 9:128697189-128697211 GCAAATCTTGTAAGAGAACTAGG + Intergenic
1061233181 9:129326823-129326845 GGACAGCTTGCAAGAGAACGGGG + Intergenic
1188443931 X:30237252-30237274 TGATCTGTTGCAAGATAACTTGG + Exonic
1188623243 X:32252189-32252211 TGAGATGTTGGTAGAGATCTTGG - Intronic
1190486511 X:50931158-50931180 AGTGATGTTGCAAAAAAACTGGG - Intergenic
1191697294 X:64003348-64003370 AGAGAGGTTGAAGGAGAACTAGG + Intergenic
1195299936 X:103518770-103518792 GGAAATATTGCAAAAGAATTAGG + Intronic
1195533803 X:105987475-105987497 GGAGTTGGTTCAAGAGAAATGGG + Intergenic
1199555169 X:149100004-149100026 GTAAATGTTCCAAGAGAACTAGG - Intergenic
1199636535 X:149818498-149818520 GCACATGTTGCAAGAGGAATAGG + Intergenic
1202021716 Y:20472226-20472248 GGAGATGTTGCAAGATCACTTGG + Intergenic