ID: 1005755840

View in Genome Browser
Species Human (GRCh38)
Location 6:28924194-28924216
Sequence GCCGCTGAAGTTTGTAGGCC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1005755840_1005755849 8 Left 1005755840 6:28924194-28924216 CCGGGCCTACAAACTTCAGCGGC No data
Right 1005755849 6:28924225-28924247 CCGGGCCCCTCGTCTTTTGTTGG No data
1005755840_1005755854 20 Left 1005755840 6:28924194-28924216 CCGGGCCTACAAACTTCAGCGGC No data
Right 1005755854 6:28924237-28924259 TCTTTTGTTGGGTTTCCTCTTGG No data
1005755840_1005755850 9 Left 1005755840 6:28924194-28924216 CCGGGCCTACAAACTTCAGCGGC No data
Right 1005755850 6:28924226-28924248 CGGGCCCCTCGTCTTTTGTTGGG No data
1005755840_1005755855 27 Left 1005755840 6:28924194-28924216 CCGGGCCTACAAACTTCAGCGGC No data
Right 1005755855 6:28924244-28924266 TTGGGTTTCCTCTTGGTGCCAGG No data
1005755840_1005755845 -10 Left 1005755840 6:28924194-28924216 CCGGGCCTACAAACTTCAGCGGC No data
Right 1005755845 6:28924207-28924229 CTTCAGCGGCTGCCGGGCCCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1005755840 Original CRISPR GCCGCTGAAGTTTGTAGGCC CGG (reversed) Intergenic
No off target data available for this crispr