ID: 1005755841

View in Genome Browser
Species Human (GRCh38)
Location 6:28924199-28924221
Sequence CGGCAGCCGCTGAAGTTTGT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1005755841_1005755850 4 Left 1005755841 6:28924199-28924221 CCTACAAACTTCAGCGGCTGCCG No data
Right 1005755850 6:28924226-28924248 CGGGCCCCTCGTCTTTTGTTGGG No data
1005755841_1005755855 22 Left 1005755841 6:28924199-28924221 CCTACAAACTTCAGCGGCTGCCG No data
Right 1005755855 6:28924244-28924266 TTGGGTTTCCTCTTGGTGCCAGG No data
1005755841_1005755854 15 Left 1005755841 6:28924199-28924221 CCTACAAACTTCAGCGGCTGCCG No data
Right 1005755854 6:28924237-28924259 TCTTTTGTTGGGTTTCCTCTTGG No data
1005755841_1005755849 3 Left 1005755841 6:28924199-28924221 CCTACAAACTTCAGCGGCTGCCG No data
Right 1005755849 6:28924225-28924247 CCGGGCCCCTCGTCTTTTGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1005755841 Original CRISPR CGGCAGCCGCTGAAGTTTGT AGG (reversed) Intergenic
No off target data available for this crispr