ID: 1005755848

View in Genome Browser
Species Human (GRCh38)
Location 6:28924225-28924247
Sequence CCAACAAAAGACGAGGGGCC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1005755848_1005755858 22 Left 1005755848 6:28924225-28924247 CCGGGCCCCTCGTCTTTTGTTGG No data
Right 1005755858 6:28924270-28924292 CAGCCCCTGCAAAAGAAAGCTGG No data
1005755848_1005755855 -4 Left 1005755848 6:28924225-28924247 CCGGGCCCCTCGTCTTTTGTTGG No data
Right 1005755855 6:28924244-28924266 TTGGGTTTCCTCTTGGTGCCAGG No data
1005755848_1005755862 28 Left 1005755848 6:28924225-28924247 CCGGGCCCCTCGTCTTTTGTTGG No data
Right 1005755862 6:28924276-28924298 CTGCAAAAGAAAGCTGGCTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1005755848 Original CRISPR CCAACAAAAGACGAGGGGCC CGG (reversed) Intergenic
No off target data available for this crispr